ID: 1104228362

View in Genome Browser
Species Human (GRCh38)
Location 12:126859288-126859310
Sequence CAGTGTCAGAACTGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104228362_1104228366 22 Left 1104228362 12:126859288-126859310 CCTGTGTCCCAGTTCTGACACTG No data
Right 1104228366 12:126859333-126859355 TCAGTAAATCTCTTTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104228362 Original CRISPR CAGTGTCAGAACTGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr