ID: 1104230354

View in Genome Browser
Species Human (GRCh38)
Location 12:126878441-126878463
Sequence GCTTCTCTAGACAATGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104230354_1104230363 27 Left 1104230354 12:126878441-126878463 CCCCATCCATTGTCTAGAGAAGC No data
Right 1104230363 12:126878491-126878513 GCCTGGTGAACTTCCTGAGCTGG No data
1104230354_1104230359 -7 Left 1104230354 12:126878441-126878463 CCCCATCCATTGTCTAGAGAAGC No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230354_1104230360 10 Left 1104230354 12:126878441-126878463 CCCCATCCATTGTCTAGAGAAGC No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104230354 Original CRISPR GCTTCTCTAGACAATGGATG GGG (reversed) Intergenic