ID: 1104230359

View in Genome Browser
Species Human (GRCh38)
Location 12:126878457-126878479
Sequence GAGAAGCTTTTGGATGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104230351_1104230359 9 Left 1104230351 12:126878425-126878447 CCTACAAGGTGGATCCCCCCATC No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230356_1104230359 -9 Left 1104230356 12:126878443-126878465 CCATCCATTGTCTAGAGAAGCTT No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230355_1104230359 -8 Left 1104230355 12:126878442-126878464 CCCATCCATTGTCTAGAGAAGCT No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230353_1104230359 -6 Left 1104230353 12:126878440-126878462 CCCCCATCCATTGTCTAGAGAAG No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230352_1104230359 -5 Left 1104230352 12:126878439-126878461 CCCCCCATCCATTGTCTAGAGAA No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data
1104230354_1104230359 -7 Left 1104230354 12:126878441-126878463 CCCCATCCATTGTCTAGAGAAGC No data
Right 1104230359 12:126878457-126878479 GAGAAGCTTTTGGATGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104230359 Original CRISPR GAGAAGCTTTTGGATGAGCG AGG Intergenic
No off target data available for this crispr