ID: 1104230360

View in Genome Browser
Species Human (GRCh38)
Location 12:126878474-126878496
Sequence GCGAGGACCCAGTTGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104230351_1104230360 26 Left 1104230351 12:126878425-126878447 CCTACAAGGTGGATCCCCCCATC No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230354_1104230360 10 Left 1104230354 12:126878441-126878463 CCCCATCCATTGTCTAGAGAAGC No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230352_1104230360 12 Left 1104230352 12:126878439-126878461 CCCCCCATCCATTGTCTAGAGAA No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230353_1104230360 11 Left 1104230353 12:126878440-126878462 CCCCCATCCATTGTCTAGAGAAG No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230355_1104230360 9 Left 1104230355 12:126878442-126878464 CCCATCCATTGTCTAGAGAAGCT No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230356_1104230360 8 Left 1104230356 12:126878443-126878465 CCATCCATTGTCTAGAGAAGCTT No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data
1104230357_1104230360 4 Left 1104230357 12:126878447-126878469 CCATTGTCTAGAGAAGCTTTTGG No data
Right 1104230360 12:126878474-126878496 GCGAGGACCCAGTTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104230360 Original CRISPR GCGAGGACCCAGTTGAAGCC TGG Intergenic
No off target data available for this crispr