ID: 1104234713

View in Genome Browser
Species Human (GRCh38)
Location 12:126922698-126922720
Sequence GTAACTTACTCAAGATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1190
Summary {0: 1, 1: 4, 2: 51, 3: 263, 4: 871}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104234710_1104234713 13 Left 1104234710 12:126922662-126922684 CCAAATTACAGAAAATGAAATGG No data
Right 1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG 0: 1
1: 4
2: 51
3: 263
4: 871
1104234709_1104234713 14 Left 1104234709 12:126922661-126922683 CCCAAATTACAGAAAATGAAATG No data
Right 1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG 0: 1
1: 4
2: 51
3: 263
4: 871

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104234713 Original CRISPR GTAACTTACTCAAGATCACA AGG Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903464782 1:23544610-23544632 GTAACTTACCCAAGGCCACAGGG + Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903953349 1:27009310-27009332 GTCACTTGCACAAGATCACGTGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904967545 1:34388894-34388916 ATAACTCACTCAAGATGAGATGG - Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905043442 1:34978154-34978176 GTAATTTGCCCAAGGTCACATGG - Intergenic
905266419 1:36757097-36757119 GTAACTTGTTCAAGTCCACATGG - Intergenic
905311745 1:37053887-37053909 GTTACTTACCCAGAATCACATGG + Intergenic
905357224 1:37393166-37393188 GTAATTAACCCAAGGTCACATGG - Intergenic
905405198 1:37727741-37727763 ATAATTTGCCCAAGATCACATGG + Intronic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
905961031 1:42042238-42042260 TTAGTTTACTCAATATCACATGG - Intergenic
906227150 1:44131457-44131479 AGAACTTTCTCAAGGTCACATGG - Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906259606 1:44377024-44377046 GTAGCTTACTTAAGGTCATAGGG - Intergenic
906267790 1:44447262-44447284 GCAACTAGCTCAGGATCACAGGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
906949244 1:50321093-50321115 GTCACTTGCCCAAGTTCACATGG + Intergenic
906951179 1:50335495-50335517 AGAACTTACCCAAGGTCACAGGG + Intergenic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907523946 1:55042892-55042914 AGAACTTACTCATTATCACAAGG - Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
907832504 1:58078303-58078325 GGAACTTCTTCAAGATCACTGGG - Intronic
907987889 1:59550873-59550895 GTAACTTGCCCAAGGCCACATGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908398885 1:63751618-63751640 GTAACTTGCCCAAAAGCACATGG - Intergenic
908463832 1:64372035-64372057 GTAACTTGACCAAGGTCACATGG - Intergenic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909597315 1:77421306-77421328 GAAGTTTACTCAAGGTCACATGG + Intronic
910141618 1:84032598-84032620 GTAAGTTTCACAAGATCTCATGG - Intergenic
910476045 1:87608620-87608642 ATCACATACTCAAAATCACACGG + Intergenic
910716287 1:90235315-90235337 GGATCTTATTCAAGACCACAAGG - Intergenic
911162213 1:94692442-94692464 ATAACTTACCCAAGATTCCATGG - Intergenic
911572614 1:99536046-99536068 GTAAATTGCTCAAAGTCACAGGG - Intergenic
912249628 1:107997396-107997418 GTAACTTGCCTAAGTTCACATGG - Intergenic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912617760 1:111122836-111122858 GTAATTTAGTCAAAATTACACGG + Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
914433180 1:147638343-147638365 GTCACTTGCTCAAGGTCATATGG + Intronic
914946954 1:152076101-152076123 GTAATTTACTCAAGGACACTTGG + Intergenic
915299522 1:154944165-154944187 TTAACTTGCCCAAGATCACTTGG + Exonic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915567349 1:156722943-156722965 GTTAATTACTCAAGACCAAAAGG + Exonic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916147428 1:161752112-161752134 ATAACCTATTCAAAATCACATGG + Intronic
916334471 1:163654757-163654779 GTTAGTAACTCAAGATCACTTGG + Intergenic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
916788173 1:168101591-168101613 GTAACTTGCCCAAGGTCACGTGG - Intronic
916870265 1:168906348-168906370 GTAACTTGCTCAAGGTTAGACGG - Intergenic
916893762 1:169139495-169139517 GTAACTTGCTCAAGGTTACCTGG - Intronic
916921221 1:169469460-169469482 ATAACTTGCTCAAGGTCATATGG - Intronic
916970930 1:170014963-170014985 ATAACTTGCCCAAGGTCACATGG + Intronic
917061080 1:171040625-171040647 GTAACTTGGTAAAGGTCACATGG - Intronic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917733492 1:177899462-177899484 GTAACTTACCCAAGGTTACAAGG + Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918643856 1:186879560-186879582 GTAACTTGTCCAAGTTCACATGG - Intronic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
920012631 1:202880489-202880511 ATAAATTACTGTAGATCACAAGG + Exonic
920270612 1:204760674-204760696 GTAACTTCCTCAAAATCTCATGG - Intergenic
920356989 1:205381060-205381082 CTAACTCACCCAAGGTCACAGGG + Intergenic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920872640 1:209806627-209806649 GTAACTTACCCAGGGTCACACGG - Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921277112 1:213531513-213531535 GTAACTTTCTCAAGGTCAGTGGG + Intergenic
921307839 1:213814781-213814803 GTAACTTATTCCAAGTCACAAGG + Intergenic
921452142 1:215321859-215321881 ATAACTTATCTAAGATCACAGGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921532107 1:216297122-216297144 GGCAATTACTCAAGAACACAGGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922021704 1:221711636-221711658 ATAACTTGCTCAAGGTTACAAGG - Intronic
922084312 1:222331360-222331382 GTAACTTGTCCAAGATCACAAGG + Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923059769 1:230460591-230460613 GTAACTTAGTCAACAACATATGG + Intergenic
923614041 1:235521798-235521820 GTTACCCACTCAAGGTCACAAGG + Intergenic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
923961612 1:239090895-239090917 GGAACTCACTCACTATCACAAGG - Intergenic
924059048 1:240152937-240152959 GTAACTCACCCAAAATCACAGGG - Intronic
924204799 1:241700668-241700690 GTAACATGCCCAAGACCACATGG - Intronic
924221534 1:241880891-241880913 ATCACTTCCTGAAGATCACAAGG - Intronic
1063215053 10:3916988-3917010 GTAACTTGCTCAAAATCTCATGG + Intergenic
1063374272 10:5544468-5544490 ATAACTTGCTCAAGGTTACATGG - Intergenic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1063636378 10:7787224-7787246 ATAACTTGCCCAAGACCACACGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1064084510 10:12335144-12335166 AGAACTTGCCCAAGATCACAAGG - Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064415898 10:15149778-15149800 GTAATTTGCTGAAGGTCACATGG + Intronic
1064577778 10:16763463-16763485 GTAACTCACTCACTATCACAAGG + Intronic
1064686896 10:17871771-17871793 GTACGTTATTCAACATCACAAGG + Intronic
1065134944 10:22658854-22658876 GTAACTCACCCGAGGTCACAAGG + Intronic
1065172137 10:23041985-23042007 GTAATTCTCTCAAGGTCACACGG - Intergenic
1065271147 10:24035139-24035161 GAAACTCACCCAAGATCTCACGG - Intronic
1065654242 10:27930718-27930740 GTAACTTCCTTAAAGTCACAAGG - Intronic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066051430 10:31639647-31639669 GAAACTCACTCAAACTCACAGGG - Intergenic
1066414589 10:35209034-35209056 ATAAGTTGGTCAAGATCACATGG + Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1066634891 10:37490594-37490616 AGAACTTGCCCAAGATCACATGG - Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067520425 10:46997317-46997339 GTAATTTCAACAAGATCACAGGG - Intronic
1067915144 10:50389502-50389524 GTGTTTTACTTAAGATCACAAGG + Intronic
1068086949 10:52385678-52385700 GCAATTTAGTCAAGTTCACATGG - Intergenic
1068856221 10:61799849-61799871 GTAACTTTCCCAAGACCACAAGG - Intergenic
1069191445 10:65495997-65496019 GTAACTTACTTAATTTCAAATGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070492423 10:76990111-76990133 GGAACTTACTCAAAGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070700681 10:78599624-78599646 GCAACTTGCTCAAGATCATGTGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1071280574 10:84098892-84098914 ATAACTTGCCCAACATCACATGG + Intergenic
1071324407 10:84497990-84498012 GTAATTTTCTCAAGGTTACAAGG + Intronic
1071356444 10:84801027-84801049 GTTGCTCTCTCAAGATCACAGGG - Intergenic
1071382977 10:85088261-85088283 TTAACTTACACAAGATTACAAGG + Intergenic
1071514243 10:86286680-86286702 GTAACTCCCTCACGGTCACATGG - Intronic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1072835896 10:98711544-98711566 ACAACTTACCCAAGGTCACATGG - Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073265287 10:102224469-102224491 GTAACTTGCCTAAAATCACATGG + Intergenic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1074187848 10:111112698-111112720 GTAACTTGCCCAAGGTTACATGG + Intergenic
1074228384 10:111509960-111509982 CTCCCTTAATCAAGATCACATGG + Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075533480 10:123250362-123250384 GTAACTTACCTAAGGTCACATGG + Intergenic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1076044360 10:127279386-127279408 GTATCTCACACAAGGTCACATGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1078132431 11:8623953-8623975 GTATCTTACCCGGGATCACAGGG + Intronic
1078196393 11:9140320-9140342 GTAGCTTGTCCAAGATCACATGG + Intronic
1078374313 11:10780639-10780661 GTAACTTGCCCAAAGTCACATGG - Intergenic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1078921103 11:15831397-15831419 GTAACTCACTCAAGGACACATGG - Intergenic
1079052598 11:17175646-17175668 GTAACCCAGTGAAGATCACAAGG + Intronic
1079238737 11:18707380-18707402 GTAACTTACCCCAGGTCACGAGG - Intronic
1079355188 11:19724735-19724757 GTAACTTGACCAAGACCACATGG + Intronic
1079525978 11:21388288-21388310 ATAACTTGATCAAGGTCACATGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079725412 11:23874692-23874714 ATAACTTTCTTAAGGTCACAGGG + Intergenic
1079914039 11:26346130-26346152 GCAACTTACTTAACATCTCAGGG - Intronic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1080694338 11:34588245-34588267 GTAATTTGCCCAAGGTCACATGG - Intergenic
1080700357 11:34639135-34639157 TTAACGTGCTCAAGGTCACATGG + Intronic
1081131428 11:39385014-39385036 GCAAATTACTCAAGATTATATGG + Intergenic
1081436297 11:43031091-43031113 GTAACTTACGAAATATCACATGG - Intergenic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081784420 11:45736825-45736847 GTAACTTACCCAAGATCATGTGG - Intergenic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1082931190 11:58607349-58607371 GAAGCTTATTCAAAATCACAAGG - Intronic
1083235088 11:61346008-61346030 TTAACTTGCTCAGGGTCACATGG - Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083959649 11:66007455-66007477 GCAACTTGCTCCAGATCGCATGG - Intergenic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085668772 11:78441283-78441305 GTAACTTAACCAATAGCACAAGG + Intronic
1085702098 11:78754774-78754796 GTAACTTTCCCAAATTCACAAGG - Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1085828873 11:79878088-79878110 GTAATTTACCCAAGGTCAGAAGG - Intergenic
1086094129 11:83033588-83033610 GTAACTTGCCCAAGGTCATAAGG + Intronic
1086262351 11:84955369-84955391 GTAACTGGCCCAAGATTACATGG + Intronic
1086356537 11:86007016-86007038 GTAACTTCCCCAAAGTCACAGGG + Intronic
1086751492 11:90500372-90500394 GTAACTTAGCCAAGGTCATAGGG + Intergenic
1086916566 11:92536430-92536452 GTCACTTGCCCAACATCACATGG - Intronic
1087008456 11:93491550-93491572 GTAACTTGCTCAGGACCACTAGG + Intronic
1087263394 11:96035865-96035887 GTAACTTGCCCACGGTCACATGG - Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1087683918 11:101242280-101242302 GTAACTCACTTAAGATTATAGGG + Intergenic
1087999618 11:104860932-104860954 GTATATTACTGAAGATCTCATGG + Intergenic
1088247891 11:107837140-107837162 GTGACTTAGTGAAGAACACAGGG + Intronic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089788062 11:120922252-120922274 CTAACTTGTTCAAGATCACGTGG + Intronic
1089974238 11:122718466-122718488 ATAACTTGCCCAAGGTCACACGG - Intronic
1090163567 11:124521385-124521407 GTAACTTATTCAAGTTCACCTGG - Intergenic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090704380 11:129323205-129323227 GTAACTTGCCCAAGGTTACATGG - Intergenic
1090804270 11:130192958-130192980 GTAACTTGCCCAACATCTCATGG - Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091503862 12:1046779-1046801 GTAAGTTGCCCAAGGTCACATGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091621520 12:2092796-2092818 TTAACTTAGCAAAGATCACATGG + Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091923413 12:4323575-4323597 GTAACTTGCTTAAAGTCACATGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092022495 12:5214235-5214257 TTAACTTACTCAAGGTCATACGG - Intergenic
1092162222 12:6321943-6321965 ATAACTTACCCAAGGTCACATGG - Intronic
1092236808 12:6815544-6815566 GTAACTCACCCAAGGTCACATGG - Intronic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092275483 12:7057834-7057856 GTAACTTTTTCAAGGTCACACGG + Intronic
1092989951 12:13886998-13887020 GTAACTAACCCAAGGTTACATGG + Intronic
1092994374 12:13934478-13934500 GTAACTTACACAAGACTGCAGGG + Intronic
1093056759 12:14563748-14563770 ATAACTGACTAAAGGTCACATGG + Intronic
1093224272 12:16462774-16462796 GTAACTTTCCCAAGATCACGTGG + Intronic
1093314814 12:17635630-17635652 GTAACTTTATGAAAATCACAGGG + Intergenic
1093417655 12:18938579-18938601 TTAACTTACTCAAGATGATATGG - Intergenic
1093851495 12:24045190-24045212 GTAACTTACCAGAGGTCACATGG - Intergenic
1094107588 12:26830970-26830992 GTAACTTTCCCAAGGTCATAAGG + Intronic
1094109890 12:26851026-26851048 GTAATTTCCTCTAGATTACATGG - Intergenic
1094719303 12:33046852-33046874 GTAATTTATTTAAGGTCACATGG - Intergenic
1095218739 12:39582301-39582323 GTAACTTACTCAGAGTCCCATGG - Intronic
1095354368 12:41254358-41254380 GTAAGATACTCAAAGTCACATGG + Intronic
1095540047 12:43299232-43299254 GTAACTTGCTCAAGGTCATTCGG + Intergenic
1096089859 12:48891607-48891629 GTCACTCACTCAAGGTTACATGG - Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096430586 12:51539713-51539735 GTAACTTTCTCAGGGTCACACGG - Intergenic
1096457096 12:51796619-51796641 AGAACTGACTCACGATCACAAGG + Intronic
1096569482 12:52513253-52513275 TTAACTTCCCCAAGATTACAGGG - Intergenic
1096767888 12:53908779-53908801 GTAACTTACTCAAAACTAGATGG - Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1097759685 12:63448764-63448786 CTAACTTTCCCAAGGTCACATGG - Intergenic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098394082 12:69999968-69999990 GTACATTACCCAATATCACATGG + Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1098964702 12:76774660-76774682 GTAATTTGCCCAAGATCATATGG - Intronic
1099122616 12:78710678-78710700 ATAACTTACTCATTATCACAAGG - Intergenic
1099132875 12:78858526-78858548 GTAATTTTTTGAAGATCACATGG - Intergenic
1099241146 12:80140591-80140613 GTAACTTGCCCAAGATCATCAGG - Intergenic
1099930719 12:89071189-89071211 GTAACTTGCCTAAGATCATAGGG - Intergenic
1099953775 12:89332630-89332652 GTAACTAGCTCAGCATCACAGGG + Intergenic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100647083 12:96542979-96543001 GCAAGTTAATCAACATCACATGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100746124 12:97647911-97647933 ATAACTTTCCCAAGATTACACGG - Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1100953550 12:99880321-99880343 ATAACTTGCCCAAGGTCACACGG + Intronic
1101060510 12:100966368-100966390 ATAGCTTGTTCAAGATCACAGGG + Intronic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101273149 12:103169511-103169533 GTAACTTATCCAAGATCATATGG + Intergenic
1101312920 12:103600005-103600027 GTAATTTGCCCAAGATTACATGG - Intronic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101599176 12:106193794-106193816 GTAAATTGCTCACAATCACATGG + Intergenic
1101747845 12:107557793-107557815 CTAATTTGCCCAAGATCACAGGG + Intronic
1101925802 12:108970302-108970324 GCAACTTACCCAGGACCACATGG - Intronic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102164836 12:110797831-110797853 GTACCTCATTCAAGGTCACAAGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102422442 12:112814675-112814697 TTAACTTGCCCAAGATCACCAGG - Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102736834 12:115169433-115169455 GTAACTTGTTCAAGTCCACACGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102861269 12:116338462-116338484 TAAACTTACCCAAGGTCACAGGG - Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103546941 12:121708957-121708979 GTAACCTCCACAAGATCTCAGGG - Intergenic
1103547062 12:121709778-121709800 GTAACCTCCACAAGATCTCAGGG + Intergenic
1103548312 12:121717494-121717516 GTCACTTATCCAAGGTCACATGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104082326 12:125441046-125441068 ATAACTTGTTCAAGGTCACATGG - Intronic
1104227144 12:126846532-126846554 GTAACTTACCTAAGGCCACACGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104985024 12:132591826-132591848 GTAACTTTCCCAAGAGCACGAGG - Intergenic
1105360766 13:19713402-19713424 ATAACTTAGTCAAGGTCATATGG + Intronic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1107382197 13:39868804-39868826 ATAAATGACTCAAGAACACAAGG - Intergenic
1107398680 13:40047448-40047470 GTAAATCCCCCAAGATCACATGG + Intergenic
1107411357 13:40161573-40161595 GTAACTTACCCAGGGTCACATGG + Intergenic
1108125036 13:47233409-47233431 ATAACTTACACAAGATGAGACGG + Intergenic
1108178668 13:47819879-47819901 GTAACTTCCACAGGGTCACATGG - Intergenic
1108450754 13:50560192-50560214 GTAACTTACACAAGGCCACACGG - Intronic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1109076219 13:57839094-57839116 GTAACTTGCCCATGATCACTTGG + Intergenic
1109560037 13:64034669-64034691 ATAACTTGTCCAAGATCACAAGG + Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1110313760 13:74081182-74081204 GTATCTTGCTTAAGATCACCTGG - Intronic
1110513371 13:76380257-76380279 CTACCTTATTCAAGGTCACATGG + Intergenic
1110973897 13:81805055-81805077 GTAACTTGCCCAAGGTCACTGGG - Intergenic
1111453201 13:88446367-88446389 GTAACTTGTCCCAGATCACACGG - Intergenic
1111813584 13:93122001-93122023 GTAACTTCCTTAAAGTCACATGG - Intergenic
1111833507 13:93358854-93358876 GTAACACACTGAACATCACAGGG - Intronic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112072733 13:95873017-95873039 GAAACTTATACAAGATCATACGG + Intronic
1112468078 13:99662247-99662269 TCAAGTTACTCAAAATCACACGG - Intronic
1112672074 13:101652340-101652362 GTAACTTACATAAGGTCACATGG - Intronic
1112686192 13:101830587-101830609 GTGACTTACTTAGGATCAAAGGG - Intronic
1113307748 13:109096484-109096506 TTCACTTACACAAGTTCACAGGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114570368 14:23662995-23663017 GTAACTTAGTCAAGGCCACATGG - Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1114995203 14:28341475-28341497 GTAACTAACCCATGGTCACAGGG - Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1115702590 14:35969264-35969286 GTAACTTATACTAGATTACATGG + Intergenic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1116764450 14:49053210-49053232 GTAACTTACCCAAGATCCTCTGG - Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117015921 14:51516601-51516623 TTTACATACTCAAGATGACAGGG - Intronic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1117538756 14:56726534-56726556 TTAACTTACCCAAGGGCACATGG + Intronic
1118241825 14:64067360-64067382 GTAACTTGCTCAAATTCACAAGG + Intronic
1118412561 14:65496932-65496954 GTAACTTGCCCAATGTCACAGGG - Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118922492 14:70162344-70162366 GTAACTTATCCAAGATTACATGG - Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120465928 14:84857322-84857344 GTAAATTCCCCAAGGTCACAGGG + Intergenic
1120519283 14:85507887-85507909 ATAACTCACTCAAAGTCACATGG - Intergenic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1120845976 14:89125590-89125612 TTAATTTGCCCAAGATCACATGG + Intronic
1120960793 14:90122981-90123003 TTAACTTAGCCGAGATCACATGG + Intronic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121294921 14:92812374-92812396 TCAGCTTACTCAAGAGCACATGG + Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122140709 14:99661234-99661256 GTAACTGGCTCAAGGTCACCTGG - Intronic
1122734634 14:103830510-103830532 GTAACTCACCCAAGATTACAGGG + Intronic
1123506922 15:20951645-20951667 GTGATTGACTCAACATCACACGG - Intergenic
1123564151 15:21525397-21525419 GTGATTGACTCAACATCACACGG - Intergenic
1123600405 15:21962681-21962703 GTGATTGACTCAACATCACACGG - Intergenic
1124873359 15:33566051-33566073 CTAACTTGCCCAAGGTCACACGG + Intronic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1125362222 15:38876299-38876321 GTAACTTGCCCAAGATCATGTGG + Intergenic
1125468181 15:39975909-39975931 GTAATTTTCCCAAGTTCACACGG + Intronic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128527080 15:68419860-68419882 GTAACTTAGCCAAGATCACCCGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128698909 15:69789747-69789769 GTAACTTGCTCAAGGTGGCATGG + Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1129799131 15:78400349-78400371 GAAACTCACCCAGGATCACATGG - Intergenic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131439891 15:92451802-92451824 GTAACTTGCACAAGATCCCACGG + Intronic
1132293083 15:100716627-100716649 GGAACTCACTCAAGGCCACATGG - Intergenic
1202972510 15_KI270727v1_random:252493-252515 GTGATTGACTCAACATCACACGG - Intergenic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133868626 16:9667671-9667693 CTAACTTGTCCAAGATCACAGGG + Intronic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134224947 16:12382427-12382449 TTAACTTGCTCAAGGGCACAGGG - Intronic
1134455161 16:14390073-14390095 GTCACTCACCCAAGGTCACAGGG + Intergenic
1134503488 16:14787333-14787355 ATAACTTGCTCAAGTTCACGTGG + Intronic
1134541404 16:15069634-15069656 GTCATTTTCCCAAGATCACATGG - Intronic
1134577079 16:15341565-15341587 ATAACTTGCTCAAGGTCACGTGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134725361 16:16414928-16414950 ATAACTTGCTCAAGGTCACGTGG + Intergenic
1134752802 16:16639509-16639531 ATAAGTTGCTCTAGATCACATGG + Intergenic
1134825899 16:17284071-17284093 GTAACTTGCCCAAGGTCACGTGG - Intronic
1134837364 16:17372745-17372767 GTAATTTGCTCAAGTTCAAACGG - Intronic
1134942071 16:18296930-18296952 ATAACTTGCTCAAGGTCACGTGG - Intergenic
1134993256 16:18719567-18719589 ATAAGTTGCTCTAGATCACATGG - Intergenic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135174025 16:20212180-20212202 GTAACTTACTCAACCTCCCATGG + Intergenic
1135359392 16:21799214-21799236 GTCATTTTCCCAAGATCACATGG - Intergenic
1135436859 16:22434191-22434213 GTCATTTTCCCAAGATCACATGG - Intronic
1135585967 16:23671147-23671169 ATAACTTGCTCAAAGTCACAAGG - Exonic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136263401 16:29097730-29097752 GTCATTTTCCCAAGATCACATGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137406639 16:48194184-48194206 GTACCTTATCCAAGGTCACACGG - Intronic
1137466466 16:48714307-48714329 GTAATTTATTCAAGAACACAGGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137760183 16:50934245-50934267 GTAACTCACTCACCATCACGTGG - Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1137854673 16:51782253-51782275 GTAACTTAACCAACTTCACATGG - Intergenic
1138680475 16:58680309-58680331 ATAACTTTCCCAAGATCACATGG + Intronic
1139182792 16:64767601-64767623 GTAACGTACCCAAGATCACTTGG + Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1139768189 16:69250497-69250519 GGAACTTATTTAAGGTCACAAGG - Intronic
1140316447 16:73902344-73902366 AGAACTGACTCACGATCACAAGG - Intergenic
1140333248 16:74078338-74078360 GTAACTAACTCAAGTTAACGAGG - Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140649165 16:77067624-77067646 GCAACATTCTCAATATCACAAGG + Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141243475 16:82284855-82284877 GTAACTTTCCCAAGATTACCAGG + Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1142533892 17:599936-599958 ATAACCTACTGAAGGTCACATGG + Intronic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143295984 17:5872444-5872466 CTAACTTACTCAGGACCACACGG + Intronic
1143355305 17:6323565-6323587 GTCACTTGCTGAAGGTCACAGGG + Intergenic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144100818 17:11940837-11940859 GTAACTTGCTTATGTTCACATGG + Intronic
1144326240 17:14184110-14184132 ATAATTTGCTCACGATCACACGG + Intronic
1144407300 17:14964468-14964490 AGAACTTAATCAAGATGACATGG - Intergenic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1144824699 17:18099236-18099258 ATCACTTGCCCAAGATCACAAGG - Intronic
1145088799 17:19968737-19968759 GTAACTTGTCCAAGATCACATGG - Intronic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146529424 17:33595650-33595672 GTAACTTACCCAATATCTCTTGG - Intronic
1146558677 17:33849430-33849452 GTAACCTACTCAAGGTCCCATGG + Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146894105 17:36528661-36528683 GTAACTTACCCAGGCTCACAGGG - Intronic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147386781 17:40087663-40087685 GTAACTTACCCCAGGTCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147638357 17:41978102-41978124 GTAACTTGCCCACGATCACATGG + Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1148187872 17:45657606-45657628 GAACCTCACCCAAGATCACATGG - Intergenic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149363857 17:55921137-55921159 GTAACTTTTCCAAGATTACATGG + Intergenic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1150478101 17:65489103-65489125 GGAACTCACTCATTATCACAAGG + Intergenic
1150845936 17:68657991-68658013 GTAACTTGCCCAAGGTCAAATGG + Intergenic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151146716 17:72047977-72047999 GTTACTTGTCCAAGATCACAGGG - Intergenic
1151190675 17:72395621-72395643 GTCACTCACTCAAGGTTACACGG + Intergenic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1153211515 18:2771269-2771291 GTAACTTATCCAAGATTACTAGG + Intronic
1153518877 18:5933193-5933215 ATAACTTAGTCAAGGTCACATGG - Intergenic
1154947182 18:21173565-21173587 GTAATTTGCTCAAGATCATGAGG + Intergenic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1155674363 18:28411540-28411562 GTAACTTGCCCAAGGTCACGTGG + Intergenic
1155813719 18:30275307-30275329 GTAACTTGGTCAAGGTTACATGG + Intergenic
1156005879 18:32440268-32440290 ATAACTTGCTTAAGATCACACGG + Intronic
1156006523 18:32449116-32449138 ATAATTTGCTCAAGGTCACATGG - Intronic
1156047405 18:32892482-32892504 ATAACTTGCTCAACATCCCAGGG + Intergenic
1156083410 18:33368677-33368699 GCAACTTGTTCAAGCTCACAAGG - Intronic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1156904135 18:42334253-42334275 ATAACTTGCTCAAGATTATAGGG - Intergenic
1156976123 18:43223421-43223443 GTAATTTATTCAAAATCTCACGG - Intergenic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157144844 18:45151420-45151442 ATAACTTGCTAAAGACCACAGGG - Intergenic
1157145305 18:45156592-45156614 GTAACTTACTTAAGGATACATGG - Intergenic
1157309300 18:46540166-46540188 GTAACTTGCCCAAAGTCACATGG + Intronic
1157485529 18:48084347-48084369 GAAACTTACTCAAAACAACAGGG - Intronic
1157634894 18:49142326-49142348 GTAACTTCCTCACTGTCACATGG + Intronic
1157808714 18:50678020-50678042 GTAACTTGCTTAGGCTCACATGG - Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158427060 18:57349805-57349827 GTAACTTACCCAAGGTCACCTGG + Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158890987 18:61871495-61871517 GTAATTTACTTAGGATCACAGGG + Intronic
1159513955 18:69434289-69434311 TTAACTTGTCCAAGATCACATGG - Intronic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1162897772 19:13775708-13775730 ACAATTTGCTCAAGATCACAGGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
924976011 2:176084-176106 GCAACTTACTGAAGTTTACATGG + Intergenic
925309012 2:2868771-2868793 GTAACTTGTCCAAGGTCACACGG + Intergenic
925501809 2:4513276-4513298 GTAACTTAGGCAAGGTCTCATGG + Intergenic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
926729327 2:16023998-16024020 ATAACTTGCTCAAAGTCACAGGG - Intergenic
926855157 2:17247969-17247991 GTAACTTGTTCAAGATCAAATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927144050 2:20149479-20149501 GTAACTTGCACACGGTCACAAGG + Intergenic
927760658 2:25750617-25750639 GTCATTTACTTAATATCACACGG - Intronic
927942724 2:27115407-27115429 TTAATTTACCCAAGGTCACAGGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928121223 2:28584914-28584936 GTAACTTTCTCAAGGTTGCATGG - Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929874699 2:45786845-45786867 GTAACTTGCACAAAATCACATGG + Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930256305 2:49096822-49096844 AGAACTTACTCACTATCACAAGG - Intronic
930360717 2:50375428-50375450 GTAACTTGCCAAAGATTACACGG + Intronic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
930769376 2:55116429-55116451 GAAACTTACCCAGGATCCCATGG - Intergenic
930880137 2:56261096-56261118 GTAAATTTCCCAAGATCACCTGG - Intronic
930883392 2:56297288-56297310 GAAACTTACTCAAAATATCAGGG + Intronic
931476510 2:62593065-62593087 GTAACTTTCTGAAGTTCACACGG + Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
931988328 2:67762900-67762922 GTAACTTGCCCAAGGTTACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932026748 2:68141481-68141503 GTAACTTGCTCCAGGCCACATGG + Intronic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
932707303 2:74036588-74036610 GTAATTGCCTCAAGATCACAAGG - Intronic
932721331 2:74140870-74140892 AAAACTTGCTCAAGGTCACATGG + Intronic
933383029 2:81574608-81574630 GTAACTTTTTCTAGATCACATGG + Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933917998 2:87016121-87016143 GTAATATACTCAAGCTGACATGG + Intronic
934004997 2:87753793-87753815 GTAATATACTCAAGCTGACATGG - Intronic
935767954 2:106387824-106387846 GTAATATACTCAAGCTGACATGG - Intergenic
935935583 2:108179075-108179097 TTAACTAACCCAGGATCACAGGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
937788004 2:125924779-125924801 GTAACTTTCCCCAGGTCACATGG - Intergenic
938185134 2:129224877-129224899 GTAAATTGCCCAAGCTCACAGGG - Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938582665 2:132661228-132661250 GAAACTAATTCAAGATCTCAAGG + Intronic
938626883 2:133119795-133119817 GTAACTTGCTTATGATCACATGG - Intronic
938707144 2:133942205-133942227 GTAGCTTTCTTATGATCACAGGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939002361 2:136751079-136751101 GTATCTTGTTCAAGGTCACAAGG + Intergenic
939735342 2:145837212-145837234 GTAACTGTGTCAAAATCACATGG + Intergenic
939763310 2:146212019-146212041 GTATCTTGCTCAAGGTCATATGG + Intergenic
940006787 2:149015747-149015769 GTAACTTGCCCAATGTCACATGG - Intronic
940199560 2:151135316-151135338 AGAACTTACTCATGATCACTAGG - Intergenic
940376129 2:152960886-152960908 TTAACTTACTCAAAGTCTCAGGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
941733845 2:168950054-168950076 TTAACTTACACATGATCACAAGG - Intronic
942627225 2:177914656-177914678 GTAACTTAGTCAAGGTGTCAAGG + Intronic
942734907 2:179098218-179098240 ATAACTTATCCAAAATCACAAGG + Intergenic
942813327 2:180022207-180022229 ATAACTTGATCAAGATCAAACGG - Intergenic
942820778 2:180111548-180111570 ATAACTTGCCCATGATCACATGG - Intergenic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
943278194 2:185896228-185896250 CTAACTTTCTCCATATCACATGG + Intergenic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944056899 2:195531741-195531763 GTTGCTTGCTCAGGATCACATGG + Intergenic
944554724 2:200876421-200876443 ATAACTTTCCCAAGGTCACAGGG + Intronic
944669383 2:201982727-201982749 CTAACTTCATCAAGATTACAGGG - Intergenic
945089174 2:206162929-206162951 GTAACATACTCAAGAGCCAAAGG - Intergenic
945109784 2:206351163-206351185 GTTACCTTCTCAAGATCATAGGG + Intergenic
945304050 2:208241807-208241829 ATGATTTACTCAAGACCACATGG - Intronic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
946919414 2:224562908-224562930 TTAATTTTCTCAAGGTCACATGG - Intronic
946949721 2:224860520-224860542 GTAACTTGCCCAAGCTCACTTGG + Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
948029897 2:234808829-234808851 GTAAATTTCTCAAGCTCTCATGG - Intergenic
1168796722 20:615072-615094 GTAAATGACTCAAGAGAACAAGG - Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168858724 20:1029375-1029397 GTCACCTACACAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1169250839 20:4060212-4060234 GTCACTTGCTCAAGGCCACATGG - Intergenic
1169874294 20:10280046-10280068 GGATCTTACTCATGATCCCAAGG + Intronic
1170258638 20:14376859-14376881 GTAACTTTCCCAATATCACATGG - Intronic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1170799144 20:19576034-19576056 GGAACTTACCCAAGTACACATGG - Intronic
1170825797 20:19794101-19794123 ATAATATACCCAAGATCACAAGG + Intergenic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1171205140 20:23273231-23273253 CTAACTTGCCCAAGGTCACATGG + Intergenic
1171432589 20:25092760-25092782 ATATTTTTCTCAAGATCACATGG + Intergenic
1171454305 20:25258860-25258882 GTAACTTGCCCAAGGGCACATGG + Intronic
1171499072 20:25579234-25579256 ATAACATACTCAGGGTCACATGG - Intronic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172318066 20:33971785-33971807 ATAACTTACTCAAAGTCACATGG - Intergenic
1172376598 20:34446839-34446861 GTAACTTACTCAAAGTCATATGG - Intronic
1172405399 20:34684895-34684917 GTAACTTGCCTAAGGTCACATGG + Intergenic
1172412206 20:34733481-34733503 ATAATTTACCCAAGGTCACATGG - Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172772110 20:37387951-37387973 ATAACTTACCCAAGGTCACATGG + Intronic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172816467 20:37691174-37691196 GTAACTTACCCAAGGACCCATGG + Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1172982417 20:38954108-38954130 GTAGCATATTCAAGATGACATGG + Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173155630 20:40606237-40606259 GTAATTGACACAAGGTCACAGGG + Intergenic
1173296206 20:41760517-41760539 TTAACTTACTTAACTTCACATGG - Intergenic
1173375204 20:42476836-42476858 GTAACTTACCCAGGGCCACATGG + Intronic
1173468025 20:43299838-43299860 ATAACTTGCCCAAGATCCCATGG + Intergenic
1173655555 20:44698194-44698216 GTAACTTCCCCAAGGCCACATGG + Intergenic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173913450 20:46688416-46688438 GTAACTTGCCCAAGGTTACACGG - Intronic
1173939979 20:46902473-46902495 GTAACTTGTCCAGGATCACATGG + Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174426611 20:50436094-50436116 GTAACTTACCCAGGGTCACCCGG - Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1174728730 20:52892707-52892729 ACAACTTTCTCAATATCACAGGG - Intergenic
1174943967 20:54964229-54964251 GGAACTTTCCCAAGATTACAGGG + Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175371901 20:58497781-58497803 AGCACTTACTGAAGATCACATGG + Intronic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1177650509 21:23954986-23955008 ATAACTTGCTCAAAATCACATGG + Intergenic
1178105119 21:29309725-29309747 GTAATTTACAGAAGATCACATGG + Intronic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178716138 21:34966169-34966191 TTAATTTGCCCAAGATCACAAGG + Intronic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1178949791 21:36976814-36976836 ATAATTTGCTTAAGATCACATGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179383564 21:40921266-40921288 GTAACTTACTCATGTTTTCAGGG - Intergenic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1180891597 22:19292436-19292458 GTAACTTACACAAACTCAGATGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182094846 22:27619200-27619222 GTAACTTGCCCAAAGTCACAAGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182723540 22:32424205-32424227 GTAACTTGCTTAAGGTCACTAGG + Intronic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182763630 22:32742993-32743015 GTAACTTACCCAAAGTAACATGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1184797202 22:46739119-46739141 GTCACTTGCCCAAGAGCACAGGG + Intergenic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
949135585 3:561088-561110 GTAAGTTGCCCAAGGTCACACGG - Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
949509923 3:4758794-4758816 GTAAATTGCCCACGATCACATGG - Intronic
949711240 3:6873468-6873490 GTAAATTGCTGAAGCTCACATGG - Intronic
949805210 3:7947582-7947604 GTTACTTGCCCAAGATCAAATGG + Intergenic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950839869 3:15957618-15957640 GTAGCTTTCCCAAGGTCACATGG + Intergenic
951358744 3:21700595-21700617 GTGAGTTACTGAATATCACAAGG - Intronic
952124370 3:30282156-30282178 GTAACTTTCCCGAGGTCACATGG + Intergenic
952215925 3:31278281-31278303 GTAACTTGCCTAAGCTCACATGG + Intergenic
952271205 3:31833315-31833337 ATAACTCACCCCAGATCACATGG - Intronic
952519185 3:34138247-34138269 GTGACTTATTCAAGCTCATAAGG + Intergenic
952743964 3:36760940-36760962 GTATCTCGCTCAGGATCACATGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
954169171 3:48786492-48786514 GTACTTTACTCAAGATAACTTGG + Intronic
955091234 3:55752714-55752736 TTAACTTACTCAAGTTTACATGG + Intronic
955132460 3:56184590-56184612 GTAACATACCCAAGATTGCAAGG + Intronic
955443641 3:58983843-58983865 GTAACCTACCTAGGATCACATGG + Intronic
955493811 3:59510383-59510405 GTAACTCACCCAAGAGCAAATGG + Intergenic
955693636 3:61614325-61614347 GTAACTCACTCAAGGTCATAGGG - Intronic
955697325 3:61649802-61649824 GTTACTTGCTCAAGATCATGTGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956090813 3:65664998-65665020 GTTACTTTTTCAAGACCACATGG - Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956104925 3:65807873-65807895 GTAAATTATCCAAGATCACAGGG + Intronic
956182276 3:66528585-66528607 GTAAGTTAATCAAGGTCACCTGG - Intergenic
956240371 3:67123371-67123393 ATAACTTACTCAAGGCCATATGG - Intergenic
956415146 3:69018177-69018199 GTAAATTGCTCAAGGTCATATGG - Intergenic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956573600 3:70725854-70725876 GTAACTTTCTCAGGTTGACAAGG + Intergenic
956702358 3:71969587-71969609 GTAAATTACCCAAGTTCAGATGG - Intergenic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
956760016 3:72433508-72433530 GTAACATACCCAAGGTCACAAGG + Intronic
957024745 3:75168762-75168784 GTAAGTTTCTCAAATTCACAGGG + Intergenic
957359819 3:79140395-79140417 GTAACTTGCCCAAAGTCACAGGG - Intronic
957449883 3:80366217-80366239 GTAGCTTAATCAAGGTCATAGGG - Intergenic
958482955 3:94667469-94667491 GAAACTAACCCAAGGTCACATGG + Intergenic
958664984 3:97126004-97126026 GAGACTTATTCAAGATCAAATGG + Intronic
958672324 3:97220628-97220650 AGAACTCACTCAATATCACAAGG + Intronic
958722693 3:97864377-97864399 GTAACTTATTCAATATCTCGGGG + Exonic
958825067 3:99020466-99020488 GTAACTTGCTCATAGTCACAAGG - Intergenic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959030830 3:101297699-101297721 GAAACTCACTCAAAACCACATGG - Intronic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960701289 3:120441883-120441905 GTAGTTTTCCCAAGATCACATGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961260769 3:125599948-125599970 GTAACTTGCCTAAGGTCACAGGG - Intergenic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961919423 3:130410437-130410459 ATAATTTCCTCAAGATCAAAAGG - Intronic
962143523 3:132816291-132816313 GTAACTTGCTGAAACTCACATGG - Intergenic
962354138 3:134679289-134679311 GTAACTTGCTCAAGGCCCCACGG + Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963313715 3:143735843-143735865 GTAGCTTGCTCAATGTCACATGG - Intronic
963318794 3:143789909-143789931 GTAACTCACTCAGGAAAACATGG - Intronic
963460172 3:145602481-145602503 GTAACTTCCTCAATATCATCAGG - Intergenic
963462440 3:145633611-145633633 GGAACTGACTTAAAATCACAAGG - Intergenic
963721451 3:148866606-148866628 GCAACTTACTCAACATCTCTGGG + Intronic
963765582 3:149332726-149332748 GTAACTTGCTGAAGGTCTCATGG + Intronic
963897098 3:150698654-150698676 GCAACTTGCCCAACATCACAAGG + Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964181264 3:153889345-153889367 GTAACTTGTTCAGGGTCACATGG + Intergenic
964478348 3:157117646-157117668 TTAATTTACTCAAAATGACATGG + Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964546640 3:157841186-157841208 GTAACTTGCTCAAAGCCACACGG + Intergenic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
964735861 3:159916217-159916239 TTAGCTTATTCAAGCTCACATGG - Intergenic
964935815 3:162085327-162085349 GTAACTTACCTAAAGTCACAAGG + Intergenic
965225047 3:165977736-165977758 GTAAATTTTTCAAGGTCACATGG - Intergenic
965375597 3:167919636-167919658 GTAACTTATTCAAAATCATAAGG - Intergenic
965450800 3:168835312-168835334 CTAACTTACTCAAGGCCACATGG + Intergenic
965501774 3:169465252-169465274 GTAACTTGCCCAAGGGCACACGG - Intronic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
965827156 3:172742877-172742899 ATAACTTGCTTAAGGTCACATGG + Intergenic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
966421457 3:179738711-179738733 GTAACCTACAGAAAATCACAAGG - Intronic
966738918 3:183213742-183213764 TTAACTCACTCAAGATTACATGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967317439 3:188162626-188162648 AGAACTTGTTCAAGATCACAGGG - Intronic
967827225 3:193886936-193886958 ATAATTTACCCAAGGTCACATGG - Intergenic
967954553 3:194868413-194868435 ATCACTTACCCAAGGTCACACGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969210717 4:5685162-5685184 GTAACTTAGGCAAAGTCACATGG + Intronic
969262430 4:6042671-6042693 GTAACTTGTCCAAGGTCACACGG + Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969983888 4:11187400-11187422 ATAACTTATGTAAGATCACAAGG + Intergenic
969999706 4:11352670-11352692 GTAACTTGCCCAAGTTCAAATGG + Intergenic
970056739 4:11982206-11982228 TTAACTTTCCCAAGATCAAATGG - Intergenic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970869289 4:20796930-20796952 ATAACTTACTCAAGAGAAAATGG - Intronic
970912858 4:21298017-21298039 ATAACTTGCTTAAGATCACAAGG - Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
972163980 4:36260170-36260192 GTAATTTGCTCAAAATCAAAAGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972361928 4:38333991-38334013 GGAACTTATGCAAAATCACATGG - Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
972979708 4:44681323-44681345 GTTACTTACTGAAAATCATATGG + Intronic
973002040 4:44962860-44962882 GAAACTTAATCAAGATTACCTGG + Intergenic
973013934 4:45111388-45111410 GTAACCTAGTCAAGGTCAAACGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973819261 4:54648403-54648425 GTGACTTACTTGAGATCACCTGG - Intergenic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
974600998 4:64079290-64079312 CTTACTTACTCAAGGTCACCAGG + Intergenic
975101804 4:70522150-70522172 GTAACTTGCCCAAGGTGACATGG - Intronic
975253614 4:72209515-72209537 GTAACTTAATTTAGAGCACATGG + Intergenic
975326830 4:73068326-73068348 GTTACTTGCACAGGATCACATGG - Intronic
975332667 4:73135620-73135642 GTAAAATAGTCAAGATCAGAAGG + Intronic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
975956431 4:79845724-79845746 ATAATTTACTCAAGATTTCAAGG + Intergenic
975959082 4:79878808-79878830 GTAACTTATTTAAGATCATATGG - Intergenic
976314639 4:83646229-83646251 GTAAATTGCCCAAAATCACACGG - Intergenic
976403180 4:84631226-84631248 ATAATTTACTGAGGATCACAGGG - Intronic
976987144 4:91315828-91315850 ATAACTTGCCCAAGGTCACATGG - Intronic
977016960 4:91702664-91702686 GTAGGCTAATCAAGATCACAAGG + Intergenic
977683542 4:99821514-99821536 GTAAATTAAACAAGTTCACATGG - Intronic
978656272 4:111069174-111069196 GTAACTTGTCCAAGGTCACATGG - Intergenic
979163838 4:117499564-117499586 GCAACATACACAAGTTCACATGG - Intergenic
979324156 4:119360035-119360057 GCAACTTAGGCAAGGTCACATGG - Intergenic
979458963 4:120958518-120958540 GTAACTTACGCAAGGTAACATGG - Intergenic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
979533200 4:121791227-121791249 ATTACTTTCTCAAGGTCACATGG - Intergenic
979709975 4:123767934-123767956 GTTACTTGCTCAGGATTACACGG + Intergenic
980002188 4:127502855-127502877 GTAATTTTCTAAAGATCCCAGGG - Intergenic
980244072 4:130215065-130215087 ATAACTTGCTCAAGTTTACATGG - Intergenic
980530677 4:134048701-134048723 GAAAATTATTCAAGATCAAAAGG - Intergenic
980573478 4:134654514-134654536 GTAACTTAATCAAGGAAACATGG - Intergenic
981259501 4:142703013-142703035 GTAACTTGCACAAAATAACATGG - Intronic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981449688 4:144882023-144882045 GTAATTCACTTAAGATCAGAGGG + Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982222743 4:153138891-153138913 TTAGCTTACTCCAGATCCCAGGG - Intergenic
982293730 4:153805934-153805956 GTAACTTTCTCAAGGTCACCTGG - Intergenic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
983241993 4:165244736-165244758 GCAACTTAGGCAAGGTCACATGG - Intronic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
983458237 4:167992434-167992456 GTAACTTACCCAAGAACTCATGG + Intergenic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
983830231 4:172317843-172317865 GGTACTTAATCAAGTTCACAAGG - Intronic
984555317 4:181206937-181206959 GAAACTCAGTTAAGATCACAGGG - Intergenic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984868541 4:184306858-184306880 ATAATTTACCCAAGGTCACATGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
984990865 4:185379737-185379759 GTAACTTGCCCAAGGCCACAGGG + Intronic
985377674 4:189359174-189359196 GTAACTTAACCAGGACCACAAGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
987037687 5:14034743-14034765 GTAATTTGCTCAAGGTCTCAAGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988555770 5:32234607-32234629 GTAACTCACTCGTGGTCACATGG - Intronic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990007127 5:50956632-50956654 GTAACTTGCACAAGATTACAGGG + Intergenic
990070463 5:51776697-51776719 GTAACTTCCTCAAATTGACATGG + Intergenic
990078674 5:51884913-51884935 GTAACTTACCTGAAATCACAAGG - Intergenic
990122676 5:52474707-52474729 GTAAACTACTCAAGAACATAGGG + Intergenic
991189579 5:63853835-63853857 GTAACTTTCTCAGGGTCACATGG - Intergenic
991206541 5:64056231-64056253 GTAACTTGTCCAAGATCACACGG - Intergenic
991319421 5:65353339-65353361 GTAACTTACCCAACAGCATAGGG + Intronic
992037472 5:72794398-72794420 CTAACTTGGCCAAGATCACATGG - Intergenic
992541335 5:77767632-77767654 AGAAATTACTCAAGAACACAAGG + Intronic
992837907 5:80658427-80658449 GTAACTTAACTAAGACCACATGG + Intronic
993008923 5:82458048-82458070 GTAACTTAATCCAGGTCACAAGG - Intergenic
993275249 5:85849469-85849491 AGAACTTACTCAATATCACAAGG + Intergenic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993570950 5:89538312-89538334 GCAACTTGACCAAGATCACAAGG + Intergenic
994068462 5:95570489-95570511 GTAACTTGCCCAAGGTTACAAGG - Intronic
994269118 5:97755719-97755741 TCAACTTACTAAAGATCACTAGG - Intergenic
994812505 5:104539430-104539452 GTAACTTCTTCAAAATCAGAAGG - Intergenic
994976916 5:106819531-106819553 GTAAATTACTCAAAGTGACATGG - Intergenic
994997347 5:107080540-107080562 GTAATTTGCCCAAGATTACAAGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
995760379 5:115555898-115555920 GTAACTTAAACAAATTCACATGG + Intergenic
996001322 5:118367899-118367921 GTAACTTGCTCAAGGATACATGG - Intergenic
996021340 5:118594026-118594048 GTAACTTGATGAAGACCACATGG - Intergenic
996786155 5:127238578-127238600 GTAACTTGCCCAAAGTCACACGG + Intergenic
997125164 5:131219218-131219240 GTCACTATGTCAAGATCACAAGG - Intergenic
997414119 5:133711980-133712002 ATAACTGACCCAAGGTCACACGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
998207758 5:140171336-140171358 GTAACTCACTCAAAGTCACATGG + Intergenic
998364819 5:141622801-141622823 GTAACTTTCTGAAGGTCACATGG - Intronic
998369158 5:141650189-141650211 GTAACTTGTCCAAGGTCACATGG + Intronic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
998534211 5:142914408-142914430 GTAATTTGCTCAAAGTCACATGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999096788 5:148986148-148986170 GTAACATACCCAAGTTCACACGG - Intronic
999252200 5:150189537-150189559 GTTACTTACTCAAAGTCACGGGG - Intergenic
999338165 5:150742482-150742504 ATAACTTGCTCAAAGTCACACGG + Intronic
999643559 5:153696149-153696171 GTAACTTTCCCAAGGCCACAGGG - Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999831234 5:155322219-155322241 GTAACCTTCTCAAGGCCACAGGG - Intergenic
1000204410 5:159044856-159044878 GTAACTTCTTAAGGATCACAAGG + Intronic
1000289533 5:159857697-159857719 GTAAGTAGCACAAGATCACAAGG + Intergenic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1000667075 5:164011741-164011763 GTAATTTACACAAATTCACATGG + Intergenic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1001041605 5:168339542-168339564 GTAACTCACCCAAGGTGACAGGG - Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001245355 5:170102001-170102023 GAAACTTGGCCAAGATCACAAGG + Intergenic
1001336810 5:170804801-170804823 ATAACTTTCTCAGGATAACAAGG - Intronic
1001837892 5:174847420-174847442 GGCACTTACTCAAGGTCACGGGG + Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003978707 6:11369045-11369067 GTAATTTGCTCAATAGCACATGG + Intronic
1004146349 6:13070493-13070515 GTAACTTGCCCAGGGTCACAGGG + Intronic
1004342637 6:14820947-14820969 GTCATTTACTCAGGGTCACATGG - Intergenic
1004638539 6:17491709-17491731 GTAACTTGCCCAAGATCATCTGG - Intronic
1005097757 6:22136618-22136640 GTAACATCCTCAAGATCAAAAGG - Intergenic
1005899311 6:30204197-30204219 GCAACTTGCCCAAGAGCACATGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007243843 6:40445804-40445826 GCAACTTGCCCAAGACCACAGGG - Intronic
1007567153 6:42860597-42860619 GTAACTTGCTCGAGAACAGATGG + Intronic
1007637998 6:43311830-43311852 GGAACTTACTCAAGAAAACTCGG - Intronic
1007758749 6:44119068-44119090 ATAACTTGCCCAAGGTCACATGG + Intronic
1008487989 6:52055856-52055878 GTTACTTACTCAAGGTTGCATGG - Intronic
1008503971 6:52211249-52211271 GTAATTTATTCAAACTCACAGGG - Intergenic
1009471892 6:64036842-64036864 GTAACTTGCTCTAGACCACACGG + Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010259569 6:73799648-73799670 GTAACTCACTCACTATCTCAAGG + Intronic
1011433787 6:87315945-87315967 GAAACTAACTCAAGTTCAAAAGG - Intronic
1011514440 6:88137188-88137210 GTATCTTGCCCAAGTTCACATGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011605313 6:89098723-89098745 GGAACAAAATCAAGATCACATGG - Exonic
1011743154 6:90383483-90383505 ATAACTTTCTCAGGGTCACAGGG - Intergenic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1012529293 6:100214786-100214808 GTAATTTTCTCAAAATCACATGG - Intergenic
1013158216 6:107514666-107514688 CTACCTTATTCAAGATTACATGG - Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013581329 6:111537351-111537373 GTAACTTGCCTAAGATCACATGG + Intergenic
1013591126 6:111620365-111620387 GCAACTTACCCAAGGCCACAAGG + Intergenic
1013651097 6:112195327-112195349 GTAACCTATTCAGGGTCACAGGG + Intronic
1013736937 6:113238994-113239016 TTAACTTGCTCAATGTCACACGG - Intergenic
1015009245 6:128324087-128324109 GTAACTTATCCAAGATCTCAGGG - Intronic
1015114495 6:129632824-129632846 CTACATTACTCAAGATCATATGG - Intronic
1015195712 6:130523042-130523064 GTCACTAACCCAAAATCACATGG + Intergenic
1015461647 6:133498305-133498327 ATAAACTACTCAAGGTCACATGG - Intronic
1015930257 6:138352148-138352170 ATAACTTACTGATGGTCACATGG + Intergenic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1016277271 6:142369461-142369483 GTAACATACCCAGGGTCACATGG + Intronic
1016331897 6:142961485-142961507 ATAATTGACTCACGATCACAGGG - Intergenic
1016745357 6:147573572-147573594 GTAACTTATGTAAGGTCACATGG - Intronic
1016745796 6:147578896-147578918 GTAACTTGCCCAAGACCACGTGG - Intronic
1017234895 6:152109112-152109134 CTCACTTACTCACTATCACAAGG + Intronic
1017508559 6:155091452-155091474 GTAAATTGCTCAATGTCACATGG + Intronic
1017587538 6:155943822-155943844 GTCACTTGCTCAAAGTCACATGG - Intergenic
1017631969 6:156404908-156404930 GTAACTTCCCCAAATTCACAAGG + Intergenic
1017746326 6:157449909-157449931 TAAACTTGCTCAAGTTCACATGG - Intronic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1018347016 6:162910227-162910249 ATAACTTCCTCAAGGTCACACGG + Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018422371 6:163650461-163650483 GTAACTTCCTGAAGACCTCAAGG - Intergenic
1018776359 6:167020598-167020620 TTAATTTACTTAAGATTACACGG + Intronic
1019029356 6:168996677-168996699 GTAACTTAATCAAATACACATGG - Intergenic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020222913 7:6255159-6255181 GTAACTTACACAAAATCACAAGG + Intronic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020458037 7:8396476-8396498 GGAACTTACTCATTACCACAAGG - Intergenic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021157392 7:17227899-17227921 GTAACTTGCCCAATGTCACATGG + Intergenic
1021189214 7:17601293-17601315 GTAACTTTCCGAAGATCACGTGG + Intergenic
1021516417 7:21492828-21492850 GTATTTTATTCAAGAGCACATGG + Intronic
1021612030 7:22466873-22466895 GTAACTTGGTCAAGATCTCATGG - Intronic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022734043 7:33059676-33059698 GTAATTTGCCCAAGGTCACATGG + Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022838532 7:34140112-34140134 GTAATTTACTCAATGTCACAGGG - Intronic
1022880826 7:34585564-34585586 GTACGTCACTCAAGGTCACATGG + Intergenic
1022993519 7:35731106-35731128 GTAACTTGCCCAAGATCGTATGG - Intergenic
1023390051 7:39701116-39701138 GTAACTGGCTCAAGGTCACGGGG + Intronic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026767599 7:73170277-73170299 CTAAGTTGCCCAAGATCACATGG - Intergenic
1027044067 7:74979985-74980007 CTAAGTTGCCCAAGATCACATGG - Intronic
1027079579 7:75222373-75222395 CTAAGTTGCCCAAGATCACATGG + Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027593539 7:80143630-80143652 GTAACTTGCCCAAGGTCTCATGG - Intronic
1027863670 7:83618256-83618278 GTAATTAACCCAAAATCACACGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028277156 7:88871244-88871266 GTAGCTTATTAAAGTTCACAGGG - Intronic
1028298388 7:89165038-89165060 ATAACTTACCCATTATCACAAGG + Intronic
1028604571 7:92642039-92642061 GTACCTTACGCCAGCTCACAGGG - Intronic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1028938969 7:96498806-96498828 GTAACCTTCTCAAGGTTACAGGG - Intronic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1029388799 7:100260965-100260987 CTAAGTTGCCCAAGATCACATGG + Intronic
1029870912 7:103691979-103692001 ATAGCTTACCCAAGACCACATGG + Intronic
1030044441 7:105482249-105482271 GTAACATACTCAAGATGCCCTGG + Intronic
1030138396 7:106281489-106281511 ATAACATACCCAAGGTCACAGGG + Intronic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1030370693 7:108695997-108696019 ATAACTTATGCAACATCACAGGG - Intergenic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1030916334 7:115318506-115318528 GGAACTCACTCACTATCACAAGG - Intergenic
1031104009 7:117516861-117516883 GTAACCTACCCAAAATCACATGG - Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032087026 7:128889852-128889874 GTAACTTGCCCAAGACCACACGG + Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032556849 7:132845130-132845152 GTAACTTACTCAGTTTCACAAGG - Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032868433 7:135953425-135953447 GTAACTTGCCCAAGATCTAATGG - Intronic
1032920205 7:136536740-136536762 GAAACTCACTCAAAACCACATGG + Intergenic
1033416950 7:141170438-141170460 GTCACTTACCCATGATCTCATGG - Intronic
1033506648 7:142009389-142009411 GTAACTTGCACAATATGACAGGG - Intronic
1033799140 7:144880099-144880121 GTAACTTTATCAAGATTACATGG + Intergenic
1033826321 7:145194542-145194564 GTAACTTATCCAAGATCACTAGG - Intergenic
1034105953 7:148490015-148490037 GTATATTGCTCAAGGTCACACGG - Intergenic
1034322830 7:150200731-150200753 GTAACTTGCCTAAGATCACGAGG - Intergenic
1034500801 7:151449212-151449234 GTAGCTTGCACAAGGTCACAGGG + Intergenic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1034681129 7:152928696-152928718 GTAACTAATTCAAGAAAACAAGG - Intergenic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1034770353 7:153768392-153768414 GTAACTTGCCTAAGATCACGAGG + Intergenic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1037089378 8:14895250-14895272 GTAATGTACCCAAGATTACATGG - Intronic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041330858 8:56722774-56722796 ATCACTTACTTAACATCACATGG - Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041755110 8:61305023-61305045 GCAACTTGCTCAAGACCCCATGG - Intronic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042652730 8:71060831-71060853 GCAACTTGGTCAAGACCACATGG + Intergenic
1042790875 8:72604445-72604467 GTAACTTGTCCAAAATCACATGG - Intronic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1043098461 8:76007057-76007079 GTTACTTACTTAAGATAACTTGG + Intergenic
1043851611 8:85222554-85222576 GTAACTTTTCCAAGATCACACGG - Exonic
1043880828 8:85540441-85540463 GTAACTTGTTCAAGATCCCATGG - Intergenic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1044365399 8:91339428-91339450 GTAATTTATTTAACATCACAAGG - Intronic
1044794556 8:95883853-95883875 GTAACTTGCTCAAAATCAAATGG + Intergenic
1044890277 8:96827744-96827766 GTAGCTTATTCAGGATCAAAAGG + Intronic
1045431597 8:102120113-102120135 ATAATTTGCTCAAGGTCACATGG - Intronic
1045439191 8:102192983-102193005 GTAACTCATTCAAGGTCACATGG + Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045698379 8:104836877-104836899 AGAACTTACTCACTATCACAAGG - Intronic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045757061 8:105556511-105556533 GTAACTTGCTAAGGATCACATGG + Intronic
1045766476 8:105677361-105677383 GTAAATTGCCCAAGGTCACAAGG + Intronic
1045951126 8:107852761-107852783 GAAATTTACTCAGGATTACATGG - Intergenic
1046398423 8:113672221-113672243 TTAACTTGCTCAAGGTAACATGG - Intergenic
1046657195 8:116907706-116907728 GTAACTAACCCAAGATCACTAGG + Intergenic
1046882983 8:119330925-119330947 GTAACTTTACCAAGAACACAGGG + Intergenic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047367635 8:124226847-124226869 ATAATTTGCCCAAGATCACATGG - Intergenic
1047657199 8:126991003-126991025 ATAACTTGGTCAAGATCACATGG - Intergenic
1047696499 8:127408797-127408819 GTAACTTACTGGACATCATAGGG + Intergenic
1047904968 8:129463152-129463174 GTAACTTGCCCAAAGTCACAGGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048241678 8:132748884-132748906 GTAATTTTCCCAAGCTCACAGGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048500632 8:134971612-134971634 TTAACTTCACCAAGATCACACGG + Intergenic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048931397 8:139318302-139318324 GTAACTTTCTCAATGTCCCAAGG - Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1050302293 9:4271901-4271923 GTAACTTAGCCACGGTCACATGG - Intronic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1051380378 9:16451966-16451988 GTATCTTGCTCAAGATCAGGAGG + Intronic
1051680409 9:19601769-19601791 GTAACTTGCCCAAGGTCTCATGG - Intronic
1052021187 9:23527382-23527404 GTAACTTTTCCAAGTTCACATGG + Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1053151055 9:35743275-35743297 GTAACATGCGCAAGGTCACAAGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1053518889 9:38756874-38756896 GAAACTTAATCAAGTTCCCAGGG + Intergenic
1053620294 9:39808236-39808258 GTATCTTAACCAAGGTCACACGG + Intergenic
1053626404 9:39875698-39875720 GTATCTTAACCAAGGTCACACGG - Intergenic
1053878467 9:42567534-42567556 GTATCTTAACCAAGGTCACACGG + Intergenic
1053894197 9:42726843-42726865 GTATCTTAACCAAGGTCACACGG - Intergenic
1054217484 9:62375003-62375025 GTATCTTAACCAAGGTCACACGG + Intergenic
1054233225 9:62534161-62534183 GTATCTTAACCAAGGTCACACGG - Intergenic
1054263861 9:62899207-62899229 GTATCTTAACCAAGGTCACACGG - Intergenic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054778287 9:69141970-69141992 GTAACTTGTTCAAGGTCACCAGG + Intronic
1054878987 9:70125374-70125396 GAAACTTGTTCAAGGTCACAGGG + Intronic
1054924478 9:70575739-70575761 GTAACTTGCCCAAGGTCGCAGGG + Intronic
1054995260 9:71380512-71380534 GTAACCAACTCAAGCCCACAGGG + Intronic
1055233909 9:74095914-74095936 GTAACACAATCAAAATCACAAGG + Intergenic
1055602239 9:77931736-77931758 GTAATTTACCCAAGGCCACAGGG - Intronic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056164775 9:83930320-83930342 GTAACTTGCTCAAGCCTACATGG + Intergenic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056255826 9:84798518-84798540 GTAACTTGCTCCAGGGCACAGGG - Intronic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056438826 9:86599551-86599573 GTAACTTACCCAGGGTCACATGG + Intergenic
1057954817 9:99399161-99399183 ATAACTTGCTCAAGGTCATATGG - Intergenic
1058417062 9:104800299-104800321 GTAACTTAGTCAAGGTTACCTGG + Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1058897272 9:109411283-109411305 GTAACTTGCCCAGGGTCACATGG + Intronic
1058953667 9:109926320-109926342 GTACCTTCCTAAAGATCACCTGG - Intronic
1059251877 9:112893113-112893135 GAAATTTGCACAAGATCACAAGG + Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059362396 9:113755088-113755110 GTAAATTGCCCAAGGTCACATGG + Intergenic
1059368549 9:113806531-113806553 GTAATTTGCCCAAGGTCACAGGG + Intergenic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059619987 9:115993260-115993282 GTAAGTTGCTCAAGGTCATACGG - Intergenic
1059686569 9:116643026-116643048 ATAATTTACTTAAGATAACATGG - Intronic
1059754090 9:117276271-117276293 GTAGCTAGCCCAAGATCACACGG + Intronic
1060000232 9:119952118-119952140 GTAACTTGCACAAGCTCACATGG + Intergenic
1060017689 9:120100902-120100924 GTACCTTTCCCAAGGTCACATGG - Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061563520 9:131422006-131422028 GTAACGCACCCAAGGTCACAAGG - Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061787154 9:133036519-133036541 GGTACTTACTCAAGAACACGGGG - Intronic
1062037136 9:134387380-134387402 GTAACTTTCCCAAGACCACGGGG + Intronic
1186369816 X:8935459-8935481 GAAACTCACTCAAAACCACACGG - Intergenic
1186588944 X:10908219-10908241 TAAACTTATTCTAGATCACAAGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187185779 X:16983848-16983870 GTAATTTGACCAAGATCACATGG + Intronic
1187444005 X:19344551-19344573 AAAACTTGCTCAAGGTCACAGGG - Intronic
1187609697 X:20928863-20928885 GTAACTTACCCAAGGTAACCTGG + Intergenic
1187633520 X:21201686-21201708 AGAACTTACTCAGTATCACAAGG + Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188442788 X:30229770-30229792 GTAATATGCTCAAGTTCACAGGG + Intergenic
1188445918 X:30253203-30253225 GTAACATTCTCAAGTTCACATGG + Intergenic
1188912967 X:35872892-35872914 AGAACTTACTCAGTATCACAAGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1189998861 X:46665236-46665258 TTAACTAACTAAAGATCACTGGG + Intronic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190490444 X:50977538-50977560 ATAACCTTCCCAAGATCACATGG - Intergenic
1190638873 X:52463751-52463773 GTATCTTGCCCAACATCACAAGG - Intergenic
1190810308 X:53876926-53876948 ATAACTCACTCACTATCACAAGG + Intergenic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193246054 X:79231678-79231700 GTGTCTTATTCAAGACCACAAGG - Intergenic
1193952168 X:87813179-87813201 CTACTTAACTCAAGATCACAAGG + Intergenic
1194550079 X:95286852-95286874 GTAATTTGCTCAAAGTCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195085080 X:101406235-101406257 GTAATTTACCCAATGTCACAGGG + Intronic
1195443085 X:104920466-104920488 ATAACTCACTCAGTATCACAAGG - Intronic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195862421 X:109396138-109396160 GTAACTTACCCGAGGTCACATGG + Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196020670 X:110987532-110987554 GCAACTTACTCCAGGTCTCACGG - Intronic
1196481538 X:116156072-116156094 GTACCTTATCCAAGGTCACACGG + Intergenic
1197100572 X:122648988-122649010 GTAACTTCCTCAGGATTAAAAGG - Intergenic
1197251365 X:124219174-124219196 GTAGGTTACCCAAGGTCACACGG + Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1198653821 X:138892241-138892263 GTAACTTTCCCAAGGACACATGG - Intronic
1198968798 X:142256388-142256410 GTAACTTAGTCAATGTCACAAGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199232278 X:145450092-145450114 GTTTCTTACTGAGGATCACAAGG + Intergenic
1199255152 X:145710901-145710923 ATAGCATATTCAAGATCACATGG - Intergenic
1199399642 X:147382808-147382830 ATAACTTGCCCAAGATTACAAGG + Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199531745 X:148855757-148855779 GTAACTTGACCAAGATCACATGG - Intronic
1199665656 X:150094566-150094588 GTAACTTGCCCAAGATCTCTTGG - Intergenic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199726693 X:150590064-150590086 ATAACCTACTCAAGGTCAAATGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1201892673 Y:18959564-18959586 GAAACTCATTCAAAATCACACGG + Intergenic