ID: 1104235548

View in Genome Browser
Species Human (GRCh38)
Location 12:126932193-126932215
Sequence GGACACAAATGCTCTCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104235548_1104235553 8 Left 1104235548 12:126932193-126932215 CCAACCTGAGAGCATTTGTGTCC No data
Right 1104235553 12:126932224-126932246 CTTCTCAACATAAGACTTTGGGG No data
1104235548_1104235551 6 Left 1104235548 12:126932193-126932215 CCAACCTGAGAGCATTTGTGTCC No data
Right 1104235551 12:126932222-126932244 GACTTCTCAACATAAGACTTTGG No data
1104235548_1104235552 7 Left 1104235548 12:126932193-126932215 CCAACCTGAGAGCATTTGTGTCC No data
Right 1104235552 12:126932223-126932245 ACTTCTCAACATAAGACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104235548 Original CRISPR GGACACAAATGCTCTCAGGT TGG (reversed) Intergenic