ID: 1104235549

View in Genome Browser
Species Human (GRCh38)
Location 12:126932197-126932219
Sequence CTTTGGACACAAATGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104235549_1104235553 4 Left 1104235549 12:126932197-126932219 CCTGAGAGCATTTGTGTCCAAAG No data
Right 1104235553 12:126932224-126932246 CTTCTCAACATAAGACTTTGGGG No data
1104235549_1104235551 2 Left 1104235549 12:126932197-126932219 CCTGAGAGCATTTGTGTCCAAAG No data
Right 1104235551 12:126932222-126932244 GACTTCTCAACATAAGACTTTGG No data
1104235549_1104235552 3 Left 1104235549 12:126932197-126932219 CCTGAGAGCATTTGTGTCCAAAG No data
Right 1104235552 12:126932223-126932245 ACTTCTCAACATAAGACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104235549 Original CRISPR CTTTGGACACAAATGCTCTC AGG (reversed) Intergenic