ID: 1104235552

View in Genome Browser
Species Human (GRCh38)
Location 12:126932223-126932245
Sequence ACTTCTCAACATAAGACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104235549_1104235552 3 Left 1104235549 12:126932197-126932219 CCTGAGAGCATTTGTGTCCAAAG No data
Right 1104235552 12:126932223-126932245 ACTTCTCAACATAAGACTTTGGG No data
1104235548_1104235552 7 Left 1104235548 12:126932193-126932215 CCAACCTGAGAGCATTTGTGTCC No data
Right 1104235552 12:126932223-126932245 ACTTCTCAACATAAGACTTTGGG No data
1104235547_1104235552 8 Left 1104235547 12:126932192-126932214 CCCAACCTGAGAGCATTTGTGTC No data
Right 1104235552 12:126932223-126932245 ACTTCTCAACATAAGACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104235552 Original CRISPR ACTTCTCAACATAAGACTTT GGG Intergenic
No off target data available for this crispr