ID: 1104236120

View in Genome Browser
Species Human (GRCh38)
Location 12:126938075-126938097
Sequence CTGTAATAGCAGAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104236113_1104236120 17 Left 1104236113 12:126938035-126938057 CCATGCCCAACATCACTAGGAAA No data
Right 1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG No data
1104236115_1104236120 11 Left 1104236115 12:126938041-126938063 CCAACATCACTAGGAAAGAAAGC No data
Right 1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG No data
1104236114_1104236120 12 Left 1104236114 12:126938040-126938062 CCCAACATCACTAGGAAAGAAAG No data
Right 1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104236120 Original CRISPR CTGTAATAGCAGAGAGGAGA AGG Intergenic
No off target data available for this crispr