ID: 1104238200

View in Genome Browser
Species Human (GRCh38)
Location 12:126960396-126960418
Sequence ATGAATTTAAATAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104238196_1104238200 1 Left 1104238196 12:126960372-126960394 CCTCTTGGCCTTCAGTAAATTCT No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238193_1104238200 19 Left 1104238193 12:126960354-126960376 CCACTCACACACCTCACACCTCT No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238192_1104238200 20 Left 1104238192 12:126960353-126960375 CCCACTCACACACCTCACACCTC No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238190_1104238200 26 Left 1104238190 12:126960347-126960369 CCAGGCCCCACTCACACACCTCA No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238191_1104238200 21 Left 1104238191 12:126960352-126960374 CCCCACTCACACACCTCACACCT No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238189_1104238200 27 Left 1104238189 12:126960346-126960368 CCCAGGCCCCACTCACACACCTC No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238195_1104238200 8 Left 1104238195 12:126960365-126960387 CCTCACACCTCTTGGCCTTCAGT No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data
1104238197_1104238200 -7 Left 1104238197 12:126960380-126960402 CCTTCAGTAAATTCTTATGAATT No data
Right 1104238200 12:126960396-126960418 ATGAATTTAAATAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104238200 Original CRISPR ATGAATTTAAATAAGCAGGG AGG Intergenic
No off target data available for this crispr