ID: 1104239673

View in Genome Browser
Species Human (GRCh38)
Location 12:126975917-126975939
Sequence TTTTCTCTTGTTATATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104239673_1104239677 10 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239677 12:126975950-126975972 TGAGTCAGCCAGCAAAAAGGAGG No data
1104239673_1104239676 7 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239676 12:126975947-126975969 GAATGAGTCAGCCAGCAAAAAGG No data
1104239673_1104239679 18 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239679 12:126975958-126975980 CCAGCAAAAAGGAGGTAAGCAGG No data
1104239673_1104239681 27 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239681 12:126975967-126975989 AGGAGGTAAGCAGGGTCTGCTGG No data
1104239673_1104239680 19 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239680 12:126975959-126975981 CAGCAAAAAGGAGGTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104239673 Original CRISPR TTTTCTCTTGTTATATTTGC AGG (reversed) Intergenic
No off target data available for this crispr