ID: 1104239679

View in Genome Browser
Species Human (GRCh38)
Location 12:126975958-126975980
Sequence CCAGCAAAAAGGAGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104239673_1104239679 18 Left 1104239673 12:126975917-126975939 CCTGCAAATATAACAAGAGAAAA No data
Right 1104239679 12:126975958-126975980 CCAGCAAAAAGGAGGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104239679 Original CRISPR CCAGCAAAAAGGAGGTAAGC AGG Intergenic
No off target data available for this crispr