ID: 1104240972

View in Genome Browser
Species Human (GRCh38)
Location 12:126989229-126989251
Sequence GTCATTCAGACCTACAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104240968_1104240972 16 Left 1104240968 12:126989190-126989212 CCAATTATTAAACACTTGTCAGC No data
Right 1104240972 12:126989229-126989251 GTCATTCAGACCTACAGTACAGG No data
1104240969_1104240972 -10 Left 1104240969 12:126989216-126989238 CCCCAGCTGAAGTGTCATTCAGA No data
Right 1104240972 12:126989229-126989251 GTCATTCAGACCTACAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104240972 Original CRISPR GTCATTCAGACCTACAGTAC AGG Intergenic
No off target data available for this crispr