ID: 1104242802

View in Genome Browser
Species Human (GRCh38)
Location 12:127007345-127007367
Sequence CGACCTCGATGCAGGCTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104242800_1104242802 -8 Left 1104242800 12:127007330-127007352 CCAGAAATGTGCTTGCGACCTCG No data
Right 1104242802 12:127007345-127007367 CGACCTCGATGCAGGCTCAGCGG No data
1104242798_1104242802 27 Left 1104242798 12:127007295-127007317 CCAGAAAAGAAACATTAGGTAAT No data
Right 1104242802 12:127007345-127007367 CGACCTCGATGCAGGCTCAGCGG No data
1104242797_1104242802 28 Left 1104242797 12:127007294-127007316 CCCAGAAAAGAAACATTAGGTAA No data
Right 1104242802 12:127007345-127007367 CGACCTCGATGCAGGCTCAGCGG No data
1104242799_1104242802 -7 Left 1104242799 12:127007329-127007351 CCCAGAAATGTGCTTGCGACCTC No data
Right 1104242802 12:127007345-127007367 CGACCTCGATGCAGGCTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104242802 Original CRISPR CGACCTCGATGCAGGCTCAG CGG Intergenic