ID: 1104246176

View in Genome Browser
Species Human (GRCh38)
Location 12:127043609-127043631
Sequence TCTAGGCTGAGCCACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104246174_1104246176 -6 Left 1104246174 12:127043592-127043614 CCAGACATGAGAATGACTCTAGG No data
Right 1104246176 12:127043609-127043631 TCTAGGCTGAGCCACAGTGAAGG No data
1104246173_1104246176 16 Left 1104246173 12:127043570-127043592 CCACGGTATTAGTGAGATCATAC No data
Right 1104246176 12:127043609-127043631 TCTAGGCTGAGCCACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104246176 Original CRISPR TCTAGGCTGAGCCACAGTGA AGG Intergenic
No off target data available for this crispr