ID: 1104246816

View in Genome Browser
Species Human (GRCh38)
Location 12:127050992-127051014
Sequence GCTCCTAACAGGCCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104246816_1104246823 7 Left 1104246816 12:127050992-127051014 CCAGTTTGTGGCCTGTTAGGAGC No data
Right 1104246823 12:127051022-127051044 CACAGCAGGAGGTTAGTGACAGG No data
1104246816_1104246820 -7 Left 1104246816 12:127050992-127051014 CCAGTTTGTGGCCTGTTAGGAGC No data
Right 1104246820 12:127051008-127051030 TAGGAGCTGGGCCTCACAGCAGG No data
1104246816_1104246821 -4 Left 1104246816 12:127050992-127051014 CCAGTTTGTGGCCTGTTAGGAGC No data
Right 1104246821 12:127051011-127051033 GAGCTGGGCCTCACAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104246816 Original CRISPR GCTCCTAACAGGCCACAAAC TGG (reversed) Intergenic
No off target data available for this crispr