ID: 1104252177

View in Genome Browser
Species Human (GRCh38)
Location 12:127105477-127105499
Sequence GGGAAATCAAGGCTGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252177_1104252188 28 Left 1104252177 12:127105477-127105499 CCTCACTGCAGCCTTGATTTCCC No data
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252177_1104252183 15 Left 1104252177 12:127105477-127105499 CCTCACTGCAGCCTTGATTTCCC No data
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252177_1104252186 18 Left 1104252177 12:127105477-127105499 CCTCACTGCAGCCTTGATTTCCC No data
Right 1104252186 12:127105518-127105540 CACCTCAGCTTCCCGAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252177 Original CRISPR GGGAAATCAAGGCTGCAGTG AGG (reversed) Intergenic
No off target data available for this crispr