ID: 1104252179

View in Genome Browser
Species Human (GRCh38)
Location 12:127105488-127105510
Sequence TGCTTGAGCCTGGGAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20738
Summary {0: 7, 1: 190, 2: 1262, 3: 4498, 4: 14781}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252179_1104252186 7 Left 1104252179 12:127105488-127105510 CCTTGATTTCCCAGGCTCAAGCA 0: 7
1: 190
2: 1262
3: 4498
4: 14781
Right 1104252186 12:127105518-127105540 CACCTCAGCTTCCCGAGTGGCGG No data
1104252179_1104252183 4 Left 1104252179 12:127105488-127105510 CCTTGATTTCCCAGGCTCAAGCA 0: 7
1: 190
2: 1262
3: 4498
4: 14781
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252179_1104252188 17 Left 1104252179 12:127105488-127105510 CCTTGATTTCCCAGGCTCAAGCA 0: 7
1: 190
2: 1262
3: 4498
4: 14781
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252179 Original CRISPR TGCTTGAGCCTGGGAAATCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr