ID: 1104252180

View in Genome Browser
Species Human (GRCh38)
Location 12:127105497-127105519
Sequence TGGGAGGATTGCTTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226437
Summary {0: 2279, 1: 12576, 2: 33112, 3: 64184, 4: 114286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252180_1104252183 -5 Left 1104252180 12:127105497-127105519 CCCAGGCTCAAGCAATCCTCCCA 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252180_1104252186 -2 Left 1104252180 12:127105497-127105519 CCCAGGCTCAAGCAATCCTCCCA 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
Right 1104252186 12:127105518-127105540 CACCTCAGCTTCCCGAGTGGCGG No data
1104252180_1104252188 8 Left 1104252180 12:127105497-127105519 CCCAGGCTCAAGCAATCCTCCCA 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252180 Original CRISPR TGGGAGGATTGCTTGAGCCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr