ID: 1104252181

View in Genome Browser
Species Human (GRCh38)
Location 12:127105498-127105520
Sequence GTGGGAGGATTGCTTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106964
Summary {0: 2177, 1: 6756, 2: 13864, 3: 22659, 4: 61508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252181_1104252183 -6 Left 1104252181 12:127105498-127105520 CCAGGCTCAAGCAATCCTCCCAC 0: 2177
1: 6756
2: 13864
3: 22659
4: 61508
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252181_1104252188 7 Left 1104252181 12:127105498-127105520 CCAGGCTCAAGCAATCCTCCCAC 0: 2177
1: 6756
2: 13864
3: 22659
4: 61508
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252181_1104252186 -3 Left 1104252181 12:127105498-127105520 CCAGGCTCAAGCAATCCTCCCAC 0: 2177
1: 6756
2: 13864
3: 22659
4: 61508
Right 1104252186 12:127105518-127105540 CACCTCAGCTTCCCGAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252181 Original CRISPR GTGGGAGGATTGCTTGAGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr