ID: 1104252183

View in Genome Browser
Species Human (GRCh38)
Location 12:127105515-127105537
Sequence TCCCACCTCAGCTTCCCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10539
Summary {0: 7, 1: 189, 2: 1087, 3: 3081, 4: 6175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252180_1104252183 -5 Left 1104252180 12:127105497-127105519 CCCAGGCTCAAGCAATCCTCCCA 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252181_1104252183 -6 Left 1104252181 12:127105498-127105520 CCAGGCTCAAGCAATCCTCCCAC 0: 2177
1: 6756
2: 13864
3: 22659
4: 61508
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252177_1104252183 15 Left 1104252177 12:127105477-127105499 CCTCACTGCAGCCTTGATTTCCC No data
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175
1104252179_1104252183 4 Left 1104252179 12:127105488-127105510 CCTTGATTTCCCAGGCTCAAGCA 0: 7
1: 190
2: 1262
3: 4498
4: 14781
Right 1104252183 12:127105515-127105537 TCCCACCTCAGCTTCCCGAGTGG 0: 7
1: 189
2: 1087
3: 3081
4: 6175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252183 Original CRISPR TCCCACCTCAGCTTCCCGAG TGG Intergenic
Too many off-targets to display for this crispr