ID: 1104252188

View in Genome Browser
Species Human (GRCh38)
Location 12:127105528-127105550
Sequence TCCCGAGTGGCGGAGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104252182_1104252188 -8 Left 1104252182 12:127105513-127105535 CCTCCCACCTCAGCTTCCCGAGT 0: 175
1: 4258
2: 26402
3: 45726
4: 84112
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252177_1104252188 28 Left 1104252177 12:127105477-127105499 CCTCACTGCAGCCTTGATTTCCC No data
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252179_1104252188 17 Left 1104252179 12:127105488-127105510 CCTTGATTTCCCAGGCTCAAGCA 0: 7
1: 190
2: 1262
3: 4498
4: 14781
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252181_1104252188 7 Left 1104252181 12:127105498-127105520 CCAGGCTCAAGCAATCCTCCCAC 0: 2177
1: 6756
2: 13864
3: 22659
4: 61508
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data
1104252180_1104252188 8 Left 1104252180 12:127105497-127105519 CCCAGGCTCAAGCAATCCTCCCA 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
Right 1104252188 12:127105528-127105550 TCCCGAGTGGCGGAGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104252188 Original CRISPR TCCCGAGTGGCGGAGACTAC AGG Intergenic
No off target data available for this crispr