ID: 1104255201

View in Genome Browser
Species Human (GRCh38)
Location 12:127130122-127130144
Sequence CAGGACTGGCCATCCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104255201_1104255209 1 Left 1104255201 12:127130122-127130144 CCAACCAAGGATGGCCAGTCCTG No data
Right 1104255209 12:127130146-127130168 GGGCTGTACCTAATTAGCATAGG No data
1104255201_1104255211 9 Left 1104255201 12:127130122-127130144 CCAACCAAGGATGGCCAGTCCTG No data
Right 1104255211 12:127130154-127130176 CCTAATTAGCATAGGATGTCCGG No data
1104255201_1104255213 28 Left 1104255201 12:127130122-127130144 CCAACCAAGGATGGCCAGTCCTG No data
Right 1104255213 12:127130173-127130195 CCGGCTGCTGTTGACCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104255201 Original CRISPR CAGGACTGGCCATCCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr