ID: 1104260967

View in Genome Browser
Species Human (GRCh38)
Location 12:127181674-127181696
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104260967_1104260975 11 Left 1104260967 12:127181674-127181696 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1104260975 12:127181708-127181730 CAGGCGTGAGCCACCATGCCCGG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
1104260967_1104260973 -8 Left 1104260967 12:127181674-127181696 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1104260973 12:127181689-127181711 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104260967 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr