ID: 1104262905

View in Genome Browser
Species Human (GRCh38)
Location 12:127201066-127201088
Sequence CTCCTTGTTGTGGCATCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104262899_1104262905 -6 Left 1104262899 12:127201049-127201071 CCCCTGCATAGTCTTATCTCCTT No data
Right 1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG No data
1104262900_1104262905 -7 Left 1104262900 12:127201050-127201072 CCCTGCATAGTCTTATCTCCTTG No data
Right 1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG No data
1104262901_1104262905 -8 Left 1104262901 12:127201051-127201073 CCTGCATAGTCTTATCTCCTTGT No data
Right 1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104262905 Original CRISPR CTCCTTGTTGTGGCATCCTG GGG Intergenic
No off target data available for this crispr