ID: 1104266006

View in Genome Browser
Species Human (GRCh38)
Location 12:127233026-127233048
Sequence TGTGTGGCTCACATTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104266003_1104266006 30 Left 1104266003 12:127232973-127232995 CCGTATTGCAGAGTTGGGTTTAA No data
Right 1104266006 12:127233026-127233048 TGTGTGGCTCACATTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104266006 Original CRISPR TGTGTGGCTCACATTGATAT AGG Intergenic
No off target data available for this crispr