ID: 1104274965

View in Genome Browser
Species Human (GRCh38)
Location 12:127318308-127318330
Sequence CTGTGGGGATGCAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104274965_1104274976 4 Left 1104274965 12:127318308-127318330 CCATCCTCACTGCATCCCCACAG No data
Right 1104274976 12:127318335-127318357 CTGGGGGGTTGTGCTTTTGTTGG No data
1104274965_1104274977 18 Left 1104274965 12:127318308-127318330 CCATCCTCACTGCATCCCCACAG No data
Right 1104274977 12:127318349-127318371 TTTTGTTGGTACTTTCCTCTTGG No data
1104274965_1104274978 26 Left 1104274965 12:127318308-127318330 CCATCCTCACTGCATCCCCACAG No data
Right 1104274978 12:127318357-127318379 GTACTTTCCTCTTGGCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104274965 Original CRISPR CTGTGGGGATGCAGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr