ID: 1104276519

View in Genome Browser
Species Human (GRCh38)
Location 12:127333587-127333609
Sequence TGAGGTCCACACTTGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104276519_1104276531 -1 Left 1104276519 12:127333587-127333609 CCTCCCAGCAAGTGTGGACCTCA No data
Right 1104276531 12:127333609-127333631 AGGGGCAGGGTGGGCAGAACGGG No data
1104276519_1104276528 -10 Left 1104276519 12:127333587-127333609 CCTCCCAGCAAGTGTGGACCTCA No data
Right 1104276528 12:127333600-127333622 GTGGACCTCAGGGGCAGGGTGGG No data
1104276519_1104276530 -2 Left 1104276519 12:127333587-127333609 CCTCCCAGCAAGTGTGGACCTCA No data
Right 1104276530 12:127333608-127333630 CAGGGGCAGGGTGGGCAGAACGG No data
1104276519_1104276532 0 Left 1104276519 12:127333587-127333609 CCTCCCAGCAAGTGTGGACCTCA No data
Right 1104276532 12:127333610-127333632 GGGGCAGGGTGGGCAGAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104276519 Original CRISPR TGAGGTCCACACTTGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr