ID: 1104285058

View in Genome Browser
Species Human (GRCh38)
Location 12:127417657-127417679
Sequence AAGCAGAAGGAAAGTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104285058_1104285069 28 Left 1104285058 12:127417657-127417679 CCTTCCTGACTTTCCTTCTGCTT No data
Right 1104285069 12:127417708-127417730 CCTAACAACGTTTAACTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104285058 Original CRISPR AAGCAGAAGGAAAGTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr