ID: 1104288388

View in Genome Browser
Species Human (GRCh38)
Location 12:127446451-127446473
Sequence CCTGTGCACCAGAGAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104288384_1104288388 -9 Left 1104288384 12:127446437-127446459 CCTTAGGGAAGGCCCCTGTGCAC No data
Right 1104288388 12:127446451-127446473 CCTGTGCACCAGAGAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104288388 Original CRISPR CCTGTGCACCAGAGAGTGCA AGG Intergenic
No off target data available for this crispr