ID: 1104290853

View in Genome Browser
Species Human (GRCh38)
Location 12:127465618-127465640
Sequence GAGCTGACTCTTATGTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104290849_1104290853 29 Left 1104290849 12:127465566-127465588 CCAGTTTGAATTCGAATCCCTAA No data
Right 1104290853 12:127465618-127465640 GAGCTGACTCTTATGTTTATGGG No data
1104290851_1104290853 11 Left 1104290851 12:127465584-127465606 CCTAAGTAAATGAACTCGACTAT No data
Right 1104290853 12:127465618-127465640 GAGCTGACTCTTATGTTTATGGG No data
1104290850_1104290853 12 Left 1104290850 12:127465583-127465605 CCCTAAGTAAATGAACTCGACTA No data
Right 1104290853 12:127465618-127465640 GAGCTGACTCTTATGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104290853 Original CRISPR GAGCTGACTCTTATGTTTAT GGG Intergenic
No off target data available for this crispr