ID: 1104291891

View in Genome Browser
Species Human (GRCh38)
Location 12:127477360-127477382
Sequence CTGAGCAAGCTCACTGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104291891_1104291894 5 Left 1104291891 12:127477360-127477382 CCAATCCCAGTGAGCTTGCTCAG No data
Right 1104291894 12:127477388-127477410 AATGCAACATCCAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104291891 Original CRISPR CTGAGCAAGCTCACTGGGAT TGG (reversed) Intergenic
No off target data available for this crispr