ID: 1104291894

View in Genome Browser
Species Human (GRCh38)
Location 12:127477388-127477410
Sequence AATGCAACATCCAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104291893_1104291894 -1 Left 1104291893 12:127477366-127477388 CCAGTGAGCTTGCTCAGTTATGA No data
Right 1104291894 12:127477388-127477410 AATGCAACATCCAAGACTGCTGG No data
1104291892_1104291894 0 Left 1104291892 12:127477365-127477387 CCCAGTGAGCTTGCTCAGTTATG No data
Right 1104291894 12:127477388-127477410 AATGCAACATCCAAGACTGCTGG No data
1104291891_1104291894 5 Left 1104291891 12:127477360-127477382 CCAATCCCAGTGAGCTTGCTCAG No data
Right 1104291894 12:127477388-127477410 AATGCAACATCCAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104291894 Original CRISPR AATGCAACATCCAAGACTGC TGG Intergenic