ID: 1104292750

View in Genome Browser
Species Human (GRCh38)
Location 12:127484467-127484489
Sequence CACGGCATTCGGGTGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104292736_1104292750 28 Left 1104292736 12:127484416-127484438 CCTAGGCTGCGTGCTGCTCCAGT No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data
1104292737_1104292750 10 Left 1104292737 12:127484434-127484456 CCAGTACATCGATGACCCCCTGC No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data
1104292740_1104292750 -5 Left 1104292740 12:127484449-127484471 CCCCCTGCTGGGACACCCCACGG No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data
1104292742_1104292750 -6 Left 1104292742 12:127484450-127484472 CCCCTGCTGGGACACCCCACGGC No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data
1104292743_1104292750 -7 Left 1104292743 12:127484451-127484473 CCCTGCTGGGACACCCCACGGCA No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data
1104292744_1104292750 -8 Left 1104292744 12:127484452-127484474 CCTGCTGGGACACCCCACGGCAT No data
Right 1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104292750 Original CRISPR CACGGCATTCGGGTGTGCCA AGG Intergenic
No off target data available for this crispr