ID: 1104293118

View in Genome Browser
Species Human (GRCh38)
Location 12:127486936-127486958
Sequence ACTTTTTTGCAGGCGTTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104293118_1104293123 30 Left 1104293118 12:127486936-127486958 CCGTACAACGCCTGCAAAAAAGT No data
Right 1104293123 12:127486989-127487011 AGTCACACCCAGAAGCTAACTGG 0: 3
1: 30
2: 82
3: 49
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104293118 Original CRISPR ACTTTTTTGCAGGCGTTGTA CGG (reversed) Intergenic
No off target data available for this crispr