ID: 1104293118 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:127486936-127486958 |
| Sequence | ACTTTTTTGCAGGCGTTGTA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104293118_1104293123 | 30 | Left | 1104293118 | 12:127486936-127486958 | CCGTACAACGCCTGCAAAAAAGT | No data | ||
| Right | 1104293123 | 12:127486989-127487011 | AGTCACACCCAGAAGCTAACTGG | 0: 3 1: 30 2: 82 3: 49 4: 133 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104293118 | Original CRISPR | ACTTTTTTGCAGGCGTTGTA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||