ID: 1104293123

View in Genome Browser
Species Human (GRCh38)
Location 12:127486989-127487011
Sequence AGTCACACCCAGAAGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 3, 1: 30, 2: 82, 3: 49, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104293118_1104293123 30 Left 1104293118 12:127486936-127486958 CCGTACAACGCCTGCAAAAAAGT No data
Right 1104293123 12:127486989-127487011 AGTCACACCCAGAAGCTAACTGG 0: 3
1: 30
2: 82
3: 49
4: 133
1104293119_1104293123 20 Left 1104293119 12:127486946-127486968 CCTGCAAAAAAGTAACTTTGAAG No data
Right 1104293123 12:127486989-127487011 AGTCACACCCAGAAGCTAACTGG 0: 3
1: 30
2: 82
3: 49
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104293123 Original CRISPR AGTCACACCCAGAAGCTAAC TGG Intergenic
900110623 1:1004002-1004024 AGTCACCCCCCTTAGCTAACAGG - Intergenic
900202291 1:1414798-1414820 AGTCACACCCGGAAGCTGACTGG - Intergenic
900687796 1:3959600-3959622 AGTCACAACCAAAGGCTAACAGG - Intergenic
902048483 1:13543404-13543426 AGCCTCACCCAGCAGCTAGCTGG - Intergenic
902862931 1:19258854-19258876 AGTGAGACCCAGAAGCTTCCAGG - Exonic
902986835 1:20159856-20159878 AGTCACACCTGGAAGCTGACTGG + Intergenic
904170561 1:28589638-28589660 AGTCACACCCGGAAGCTGACTGG - Intronic
906499123 1:46328141-46328163 AGTCATACCCGGAAGCTGACTGG - Intergenic
907529542 1:55080406-55080428 ACTCAGACCCAGAAGCTACTAGG - Intronic
908501928 1:64752479-64752501 AGGCACACTCAGAAACTAACTGG - Intronic
909534516 1:76721348-76721370 AGTCACCCCAAGAAGTAAACTGG - Intergenic
910499461 1:87872884-87872906 AGTCACAGCCTGAAGGTAGCTGG - Intergenic
910852763 1:91665017-91665039 AGTCACACCCAGAAGCTGACTGG - Intergenic
911413177 1:97536852-97536874 AGTCTCACCAGGAAGCTAATGGG - Intronic
912816225 1:112830835-112830857 AGTCACACCCAGAAGCTGACTGG + Intergenic
912980219 1:114364703-114364725 AGTCACACCTGGAAGCTGACTGG - Intergenic
913571923 1:120129256-120129278 AGTGACACCATGAAGCTCACTGG - Intergenic
914292842 1:146290879-146290901 AGTGACACCATGAAGCTCACTGG - Intergenic
914553886 1:148741662-148741684 AGTGACACCATGAAGCTCACTGG - Intergenic
916766660 1:167867291-167867313 AGTCACACCCGGAAGCTGACTGG + Intronic
917587894 1:176446463-176446485 AGTCACACACAGGACATAACAGG - Intergenic
917748170 1:178030831-178030853 AGTCACATCCGTAAGCTTACAGG - Intergenic
918646990 1:186916944-186916966 AGTCACACCCAGAAGCTGACTGG - Intronic
920450371 1:206056306-206056328 AGTCACACCCGGAAGCTGACTGG + Intronic
921074834 1:211691999-211692021 AGTCACACCCGGAAGCTGACTGG + Intergenic
921927347 1:220722371-220722393 AGTCACACCCGGAAGCTGACTGG + Intergenic
922136793 1:222836414-222836436 AGTCACTCCCAGATGTTAAATGG - Intergenic
922553071 1:226511498-226511520 AGTAACAGTCAGCAGCTAACTGG - Intergenic
922680555 1:227591948-227591970 AGTCACACGCGGAAACTGACTGG - Intronic
922690351 1:227684157-227684179 AGTCACACCCAAAAGCTGACTGG + Intergenic
924744052 1:246816088-246816110 TGAAACACACAGAAGCTAACAGG - Intergenic
924858872 1:247900890-247900912 AGTCACACCTGGAAGCTGACTGG - Intergenic
1065802224 10:29363028-29363050 AGTCACACCTGGAAGCTAACTGG - Intergenic
1065931223 10:30480643-30480665 AGTCACACCCGGAAGCTGACTGG + Intergenic
1067346553 10:45442510-45442532 AGACACACTCACAAGCTCACTGG - Intronic
1067818025 10:49497866-49497888 AGTCATACCCAGAACTTACCAGG + Intronic
1068671602 10:59729044-59729066 AGTCACACCTGGAAGCTGACTGG - Intronic
1069939452 10:71944442-71944464 AGTTACACCTGGAAGCCAACTGG + Intergenic
1069950874 10:72017249-72017271 AGTCTCAGCCAGAAGCTGACAGG - Intergenic
1071282423 10:84114606-84114628 AGTCACACCCGGAAGCTGACTGG + Intergenic
1071288227 10:84168593-84168615 GGTCACACCCGGAAGCTGACTGG - Intergenic
1072335009 10:94390032-94390054 AGTCACACCCAGAAGCTGACTGG + Intergenic
1072688991 10:97558045-97558067 AGTCACACCCAGAAGCTGACTGG - Intronic
1077186437 11:1237407-1237429 AGTCACACCCAGAGGCTCACAGG + Intronic
1077588837 11:3476125-3476147 AGTCACACCCGGAAGCTGACTGG - Intergenic
1079009278 11:16815037-16815059 AGTAGCATCCAGAAGCAAACAGG + Intronic
1081181744 11:39992543-39992565 ATTCAAACCCAAAACCTAACAGG - Intergenic
1081811206 11:45915084-45915106 AGTGAGGCCCAGAAGCTGACGGG + Intronic
1083082021 11:60103947-60103969 AGTCACACCCGGAAGCTGACTGG - Intergenic
1083090077 11:60190609-60190631 AGTCACATCCAGAAGCTGACTGG + Intergenic
1084346035 11:68549557-68549579 AGACACACCCAAAAGGAAACAGG - Intronic
1084828149 11:71746815-71746837 AGTCACACCCGGAAGCTGACTGG + Intergenic
1085025851 11:73236114-73236136 AGTCAGGCACAGAAGCCAACTGG - Exonic
1085998939 11:81955384-81955406 AGTCACACCCGGAAGCTGACTGG + Intergenic
1086973259 11:93106077-93106099 AGTCACACCCGGAAGCTGACTGG - Intergenic
1087347319 11:96988462-96988484 AGTCAGACACAGATGCTTACAGG - Intergenic
1087684712 11:101249718-101249740 AGTCACACCCGGAAGCTGACTGG + Intergenic
1089368647 11:117937639-117937661 AGTCAGACCCACAGGCAAACAGG + Intergenic
1091814316 12:3424923-3424945 AGTCACACCCGGAAGCTGACTGG - Intronic
1092415097 12:8284890-8284912 AGTCACACCCGGAAGCTGACTGG - Intergenic
1095062787 12:37720883-37720905 ATTCACACCCAGAAACTACACGG + Intergenic
1098248595 12:68545393-68545415 AGTCACACCTGGAAGCTGACTGG + Intergenic
1098639347 12:72820836-72820858 AGTCACACCCGGAAGCTGACTGG - Intergenic
1098748836 12:74270466-74270488 AGTCACACCCGGAAGCTGACTGG + Intergenic
1099958213 12:89371839-89371861 TCTCACACCCTGAAGCTAGCAGG + Intergenic
1100030855 12:90189149-90189171 TGTCAAACCCAGATGCCAACAGG + Intergenic
1100278209 12:93091897-93091919 GGTCACTCCCAGAAGCTGTCTGG - Intergenic
1101738127 12:107478861-107478883 GGACAAACCCAGAAGCTAATGGG - Intronic
1104276891 12:127337199-127337221 AGTCACCCGCAGCAGCTAAGAGG - Intergenic
1104293123 12:127486989-127487011 AGTCACACCCAGAAGCTAACTGG + Intergenic
1105695797 13:22887255-22887277 AGTCGCACCCGGAAGCTGACTGG + Intergenic
1105796647 13:23860818-23860840 ATTCTCACCCAGATGGTAACTGG - Intronic
1108285573 13:48904774-48904796 AATCACAACCAGCAACTAACAGG + Intergenic
1109803191 13:67403329-67403351 AGTCACACCTCTAAGCTGACTGG + Intergenic
1110114976 13:71802322-71802344 AGTCACAAGCAGTGGCTAACTGG + Intronic
1110653523 13:77970977-77970999 AGTCACACTTGGAAGCTGACTGG - Intergenic
1112253853 13:97809484-97809506 AGCCAGACCCAGAGGCTAACAGG + Intergenic
1112356182 13:98676408-98676430 AGTCCCACCCAGCTACTAACAGG - Intergenic
1113986292 13:114318726-114318748 AGTGACAATCAGAAGCTAGCAGG - Intronic
1116058456 14:39893290-39893312 AGACACACCCAGGAGGTAGCAGG - Intergenic
1117955011 14:61116112-61116134 AGTCACACCCGGAAGCTGACTGG - Intergenic
1121492603 14:94370742-94370764 AGTCACACCCAGGAGCCCTCGGG - Intergenic
1125066541 15:35493177-35493199 AGTCACAAACAAAAGCTAATTGG + Intronic
1127096097 15:55513694-55513716 AGTCACACCCGGAAGCTGACTGG - Intergenic
1127487912 15:59436636-59436658 AGTTACAGCCAGAAGGTCACTGG + Intronic
1132543390 16:521793-521815 AGACACACCCAGAAGAAAACAGG - Exonic
1133116980 16:3582972-3582994 GGTCAAACCCAGAAGGTGACGGG + Intronic
1133649752 16:7800625-7800647 AGACACATCCAGAGGCTATCTGG + Intergenic
1133867737 16:9659724-9659746 AGACACACAGAGAAGGTAACAGG - Intergenic
1134054956 16:11164301-11164323 AGTCACCCCCAAAACCCAACTGG + Intronic
1137041431 16:35616359-35616381 AGTCACACCCGGAAGCTAACTGG - Intergenic
1139563689 16:67759530-67759552 AGTGACACCCAGAAGCATAGTGG + Intronic
1139587216 16:67911765-67911787 AGCCACATCCAGAAGCTGTCAGG - Intronic
1140700960 16:77581158-77581180 TGTCACAGGCAGCAGCTAACTGG - Intergenic
1140728807 16:77837936-77837958 ATTTACAGCCAGAAGCAAACAGG + Intronic
1141242387 16:82275645-82275667 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242454 16:82276053-82276075 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242487 16:82276257-82276279 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242537 16:82276563-82276585 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141433255 16:83981736-83981758 AGGCACACCCAGGAGGCAACTGG + Intronic
1141883942 16:86879078-86879100 AGTCTCACCCAGGACCTCACAGG - Intergenic
1142737418 17:1909959-1909981 ATTCCCACCCAGAAGGGAACTGG - Intergenic
1142784710 17:2211825-2211847 AGCCACACCCAGAGGGAAACAGG - Intronic
1144170016 17:12650195-12650217 GGACACACTCAGAAGCTAAAGGG + Intergenic
1144647838 17:16987530-16987552 AGGCACACCCAAAAGCAACCCGG + Intergenic
1145398729 17:22514869-22514891 TGTCACTCCCAGAAGCCATCTGG + Intergenic
1145864641 17:28233095-28233117 AGTCACACCCAGAAGCTGACTGG - Intergenic
1145924835 17:28638766-28638788 AGACACACCTAGAAGATAAAAGG + Intronic
1146764359 17:35505781-35505803 AGTCACACCCAGAAGCTAACTGG + Intronic
1147592774 17:41695572-41695594 AGTCACACCCAGAGGTGAAAAGG + Intergenic
1147810112 17:43162764-43162786 AGTCACACCCAGAAGCTGACTGG - Intergenic
1148828767 17:50415275-50415297 ACTCACACCCGGAAGCTGACTGG - Intergenic
1149923153 17:60677779-60677801 AGCCAATCCCAGAAGCAAACCGG - Intronic
1152455152 17:80410938-80410960 AGTCACAACTGGAAGCTGACTGG + Intergenic
1152784355 17:82240290-82240312 AGTCCCACCCAGCAGCTGAAGGG + Intronic
1154013942 18:10599945-10599967 AGTCACACCCGGGAGCTGACTGG - Intergenic
1155277645 18:24204215-24204237 AGTCAGACCCAAAACCTAAAAGG - Intronic
1155471522 18:26197026-26197048 AGAAACACCCAGACGCTTACTGG + Intergenic
1157128573 18:44981317-44981339 AGTCACCTCCTGAAGCCAACTGG - Intronic
1158129951 18:54141234-54141256 AGCCACACCAAGAACCGAACAGG - Intergenic
1158292285 18:55955422-55955444 AGTCACACCCGGAAGCTGACTGG + Intergenic
1162282090 19:9706982-9707004 AGTCACACCCGGAAGCTGACTGG + Intergenic
1162633020 19:11943865-11943887 TGTCACACCTGGAAGCTGACTGG - Intronic
1163934349 19:20428674-20428696 AGTCACACCCAGAAGCTGACTGG - Intergenic
1163943015 19:20512436-20512458 AGTCACACCCAGAAGCTGACTGG - Intergenic
1163966166 19:20749413-20749435 AGTCACACCCGGAAGCTGACTGG - Intronic
1163992214 19:21009071-21009093 AGTCACACCTGGAAGCTGACTGG + Intergenic
1164216758 19:23157410-23157432 AGTCACACCTGGAAGCTGACTGG - Intergenic
1164481272 19:28612665-28612687 AGTCACACCCGGAAGCTGACTGG + Intergenic
1167581856 19:50349587-50349609 AGTCACACCCGGAAGCTGACTGG - Intronic
1167935295 19:52901404-52901426 AGTCACACCCGGAAGCTGACTGG - Intergenic
1167942770 19:52960888-52960910 AGTCACACCCGGAAGCTGACTGG + Intronic
925540839 2:4966037-4966059 AGTGACACCCAGTAGCAAGCAGG + Intergenic
926145871 2:10396924-10396946 AGTCACTCCCAGAGGCCGACTGG + Intronic
926491249 2:13528527-13528549 AGTCACACCCGGAAGCTGACTGG - Intergenic
930518754 2:52436930-52436952 AGTCACACCCGGAAGCTGACTGG + Intergenic
931698222 2:64888198-64888220 AATCACACCCGGAAGCTGACGGG - Intergenic
933706476 2:85294567-85294589 GGTCACTCTCAGAAGCAAACTGG + Intronic
933935855 2:87203374-87203396 AGTCACACTCAGAAGCTGACTGG - Intergenic
935667581 2:105525810-105525832 AGTCAGACTCAGACGCTCACTGG + Intergenic
935721293 2:105981653-105981675 AGTCACACCCGGAAGCTGACTGG - Intergenic
935970780 2:108528873-108528895 AGTCACACCCGGAAGCTGACTGG + Intergenic
936357294 2:111762456-111762478 AGTCACACTTGGAAGCTGACTGG + Intergenic
936419401 2:112349012-112349034 AGTCACACCCGGAAGCTGACTGG - Intergenic
938776951 2:134550430-134550452 AGTCACTCTCAGAAGCAACCTGG + Intronic
939419383 2:141946221-141946243 AGAAACACCCAGAAGATAAAGGG - Intronic
943408299 2:187515559-187515581 AGTCACACCCAGAAGCTGACTGG + Intronic
943561651 2:189470857-189470879 ACTCACACCAACAAGCAAACAGG + Exonic
947595117 2:231406230-231406252 AGTCACGCCCGGAAGCTGACTGG + Intergenic
948309916 2:236977367-236977389 AGGCACACCCAGAGGCTTACAGG - Intergenic
1170400915 20:15982469-15982491 AGTCACACTCAGAAGCTGACTGG - Intronic
1171408721 20:24931573-24931595 AGTCACACCCAGAAGCTGACTGG + Intergenic
1173713467 20:45180570-45180592 AGTCAAACCCAGAAAAGAACTGG + Intergenic
1175513697 20:59554137-59554159 AGTCACACCCAGAAGCTGACTGG - Intergenic
1177355112 21:19997730-19997752 AGTCATACCTGGAAGCTGACTGG - Intergenic
1178399091 21:32268063-32268085 ACTCACACCCAGAAACAAAGGGG + Intergenic
1178447912 21:32662189-32662211 AGTCACACCCGGAAGCTGACTGG + Intronic
1178847396 21:36184938-36184960 AGTCACACCCAGAACAGAACTGG - Intronic
1179669257 21:42934205-42934227 AGTCACACCCGGAAGCTGACTGG + Intergenic
1179670691 21:42945336-42945358 AGTCACACCTGGAAGCTGACTGG - Intergenic
1180227564 21:46404561-46404583 AATCACACCCAGAAACTATGAGG - Intronic
1184846095 22:47088156-47088178 GGTCACAGCCAGAAGATAAGAGG - Intronic
1185292147 22:50032491-50032513 AGTCACACCCAGAAGAGGCCTGG - Intronic
949158325 3:852568-852590 TGTTACACCCAGAAGCTGGCTGG + Intergenic
951165833 3:19484486-19484508 AGTCACATCCAGAAGCTGACTGG - Intronic
951248354 3:20366543-20366565 AGTCACACCCGGAAGCAGACTGG - Intergenic
955193940 3:56787606-56787628 AGTCATACCCAGTAATTAACTGG + Intronic
956996194 3:74828775-74828797 AGTCACACCCGGAAGCTGACTGG + Intergenic
957022704 3:75142347-75142369 AGTCACACCCGGAAGCTGACTGG + Intergenic
957406405 3:79778409-79778431 AGTCACACCCGGAAGCTGACTGG + Intergenic
957999710 3:87736133-87736155 AGTCACACCCGGAAGCTGACTGG - Intergenic
961892650 3:130143501-130143523 AGTCACACCCTGAAGCTGACTGG - Intergenic
962096551 3:132298645-132298667 AGTCACACCCGGAAGCTGACTGG - Intergenic
962097570 3:132307835-132307857 AGTCACACCCGGAAGCTGACTGG + Intergenic
962146005 3:132840812-132840834 AGTCACAGCCAGCAGCTCCCAGG + Intergenic
962277258 3:134025063-134025085 AGTCACACCCGGAAGCTGACTGG + Intronic
964932814 3:162047097-162047119 AGTTACACCCAGAAGCTGACTGG - Intergenic
966703026 3:182877313-182877335 AGTGACACTAAGAAGCAAACGGG + Intronic
968263418 3:197343364-197343386 AGGCACACATTGAAGCTAACAGG + Intergenic
969503658 4:7570461-7570483 AGGCGCCCCCAGCAGCTAACAGG + Intronic
969750114 4:9103643-9103665 AGTCACATCCAGAAGCTGACTGG + Intergenic
972217247 4:36910798-36910820 AGTCACACCTGGAACCTGACTGG + Intergenic
972275113 4:37549860-37549882 AGTCACACCCAGAAGCTGACTGG + Intronic
972933188 4:44100642-44100664 AGTCTTCCCCAGAAGCCAACCGG - Intergenic
972991036 4:44822863-44822885 AGTCACACCCGAAAGCTGACTGG - Intergenic
974949665 4:68572823-68572845 AGTCACACCCAGAAGCTGACTGG - Intronic
974988143 4:69054735-69054757 AGTCACACCCAGAAGCTGACTGG + Intronic
975067631 4:70087607-70087629 AGTCATTCCCAGAAGATAATTGG - Intergenic
975205851 4:71643404-71643426 AGTCACATCTGGAAGCTGACTGG + Intergenic
976969829 4:91091591-91091613 AGTCACACCCGGAAGCTGACTGG - Intronic
976990140 4:91355696-91355718 AGTCACACCCGGAAGCTGACTGG - Intronic
977043364 4:92040993-92041015 GGTCACACCCGGAACCTGACTGG - Intergenic
977972581 4:103228877-103228899 ATTCACACCCTGAAGCTGACTGG + Intergenic
979052647 4:115953922-115953944 GGTCACACCCAGAAGCTGACTGG + Intergenic
980073197 4:128265091-128265113 AGTCACACCCGGAAGCTAACTGG + Intergenic
980780344 4:137484459-137484481 AGTCACACCCGGAAGCTGACTGG + Intergenic
982662577 4:158224754-158224776 AGTCACACCCAGAAGCTGACTGG - Intronic
983708638 4:170688145-170688167 AGTCACACCTGGAAGCTGACTGG + Intergenic
983813464 4:172093536-172093558 CGTCCCACCCAGATCCTAACAGG - Intronic
983898168 4:173103673-173103695 AGTCACACCCAGAAGCTGACTGG + Intergenic
987930356 5:24393392-24393414 AGTCACACCTGGAGGCTGACTGG - Intergenic
989095843 5:37780623-37780645 AGTCACACCCAGAAGCTGACTGG - Intergenic
989557782 5:42817194-42817216 AGTCACACACGGAAGCTGACTGG + Intronic
991226817 5:64283346-64283368 AGTAACACCCACAAGCTTAAAGG - Intronic
991306283 5:65179057-65179079 AGTCACACCCGGAAGCTGACTGG + Intronic
992078473 5:73213425-73213447 AATCACAACCACAAGCAAACAGG - Intergenic
992579502 5:78157272-78157294 TGTAACACCCTGGAGCTAACAGG - Intronic
992989500 5:82269848-82269870 AGTCACACCCGGAAGCTGACTGG - Intronic
993327974 5:86565882-86565904 AGTCATACCTGGAAGCTGACTGG - Intergenic
993461563 5:88189338-88189360 AGTCACACCCGGAAGCTGACTGG - Intergenic
995474027 5:112530063-112530085 AGTCACACCTGGAAGCTGACTGG + Intergenic
995867613 5:116708110-116708132 AGTCACACCCGGAAGCTGACTGG + Intergenic
1000604702 5:163315625-163315647 AGTCACACCGGGAAGCCTACTGG - Intergenic
1002407929 5:179051031-179051053 AGTCACACCCGGAAGCTGACGGG - Intergenic
1002641583 5:180633061-180633083 GGTCCCGCCCTGAAGCTAACGGG + Intronic
1002852954 6:1012532-1012554 AGTCACACCCAGAAGTCAGGAGG - Intergenic
1003269007 6:4591029-4591051 AGTGACTCCAAGAAGTTAACTGG - Intergenic
1003424285 6:5986953-5986975 AGACACCCCCAGAAGCTGAAGGG - Intergenic
1004348971 6:14874406-14874428 AGTCCCCCCCAGCAGCTAACTGG + Intergenic
1005462128 6:26079152-26079174 AGTCACACCCGGAAGCTGACTGG + Intergenic
1006031978 6:31183018-31183040 AGTCACACCCAGAAGCTGACTGG - Intergenic
1006570800 6:35002346-35002368 AGTTACACCCGGAAGCTGACTGG + Intronic
1007960106 6:45951175-45951197 TGTCTGACCCAGAAACTAACAGG - Intronic
1010317954 6:74472035-74472057 AGTCACACCCAGAAGCTGACTGG + Intergenic
1011565555 6:88668368-88668390 AGTCACACCTGGAAGCTGACTGG + Intronic
1011664031 6:89617829-89617851 AGTCACACCCAGCACCTACGTGG - Intronic
1012611484 6:101225734-101225756 CGTCACACCCAGAAGCTGACTGG - Intergenic
1013559101 6:111286752-111286774 AGTCACACCTGGAAGCTGACTGG - Intergenic
1013956733 6:115850946-115850968 AGTCACACTGAGAAGCTAGATGG + Intergenic
1014546696 6:122744068-122744090 AGTCACACCCGGAAGCTGACTGG - Intergenic
1015172120 6:130265372-130265394 AGTCACACCTGGAAGCTGACTGG + Intronic
1015802687 6:137076703-137076725 AGTGACACCCAGTGGCTAGCTGG - Intergenic
1016080643 6:139851139-139851161 CGACACACTAAGAAGCTAACTGG + Intergenic
1017017982 6:150116774-150116796 AGTCACAACCAGGAGCCACCGGG + Intergenic
1018862831 6:167723273-167723295 ACTCACACACAGAAACCAACAGG + Intergenic
1019448409 7:1083255-1083277 AGTCACGCCCAGGGGCTGACGGG + Intronic
1020322864 7:6953001-6953023 AGTCACACCCAGAAGCTGACTGG - Intergenic
1020838823 7:13188533-13188555 AGTGACACCCAGATGCTAAACGG - Intergenic
1021303016 7:18995619-18995641 AGTCTCCTCCAGAAGCTAGCTGG + Intronic
1021849167 7:24791005-24791027 AGTCACACCTGGAAGCTGACTGG - Intergenic
1027183734 7:75957272-75957294 AGCCACACCCTGAAGCTGAAAGG + Intronic
1029486294 7:100844017-100844039 AGTCACACCCGGAAGCTGACTGG + Intronic
1032170967 7:129584152-129584174 AGTCACACCCGGAAGCCGACTGG + Intergenic
1032782502 7:135175212-135175234 AGTCACACCTGGAAGCTGACTGG + Intergenic
1032979379 7:137264452-137264474 AGTCACACCCGGAAGCTGACTGG - Intronic
1034917134 7:155049717-155049739 TGTGACACCCAGAAGGTGACAGG - Intergenic
1034920087 7:155072327-155072349 AGTCACACCTACAACCTAATAGG - Intronic
1035335411 7:158124821-158124843 AGTCACAGCCAGATTCCAACAGG + Intronic
1036373196 8:8177981-8178003 AGTCACACCTGGAAGCTGACTGG + Intergenic
1036877708 8:12487660-12487682 AGTCACACCTGGAAGCTGACTGG - Intergenic
1038089856 8:24240744-24240766 AGTCACACCCAGAAGCTGACTGG + Intergenic
1039382310 8:37097586-37097608 AGTCACACACAGAGGCACACAGG - Intergenic
1041227333 8:55713473-55713495 AGTCACGCCCAGAAGCTGACTGG + Intronic
1041515662 8:58696280-58696302 AGTCACACCCAGAAGCTGACTGG + Intergenic
1044329986 8:90907265-90907287 AGACAGGCTCAGAAGCTAACTGG - Intronic
1048957163 8:139546743-139546765 AGTCACACCCAGAAGCTGACTGG - Intergenic
1049634082 8:143676865-143676887 AGTCACGCCCAGAAGCTGACTGG + Intergenic
1049882067 8:145071929-145071951 AGTCACACCCGGAAGCTGACTGG - Intergenic
1052508288 9:29382318-29382340 AGTCACACCTGGAAGCTGACTGG + Intergenic
1053002980 9:34587781-34587803 GCTCACACCCAGAATCTCACTGG - Intronic
1056569235 9:87801448-87801470 AGTCCCATTCAGATGCTAACTGG + Intergenic
1056615290 9:88160261-88160283 GGTCACACACAGAAGCAAAGAGG - Intergenic
1057593088 9:96390919-96390941 TGTCCCAGCCAGAAGCTTACTGG - Intronic
1058761894 9:108142276-108142298 TGTCACAGCCAGAACCTCACTGG + Intergenic
1060231308 9:121827418-121827440 AGTCACACTCAGCAACTGACAGG + Intronic
1062223873 9:135437820-135437842 AGTCACACCCGGAAGCTGACTGG - Intergenic
1185910162 X:3973599-3973621 AGTCACACCCAGAAGCTGACTGG + Intergenic
1186558531 X:10586322-10586344 AGTCACACCCAGAAGCTAACTGG - Intronic
1190270471 X:48859211-48859233 AGTCACACCCGGAAGCTGACTGG + Intergenic
1190314555 X:49142094-49142116 AGTCACACTCAGAAGCTGACTGG - Intergenic
1190425638 X:50332549-50332571 AGTCACACCCGGAAGCTGACTGG - Intronic
1190771433 X:53517879-53517901 AGTCACACCCGGAAGCTGACTGG + Intergenic
1191035848 X:56026028-56026050 AGTCAAACCCGGAAGTTGACTGG - Intergenic
1191639425 X:63414137-63414159 AGTCACACTCAGAAGCTAACTGG + Intergenic
1191917768 X:66221116-66221138 AGTCACACCCGGAAGCTGACTGG - Intronic
1192915273 X:75645246-75645268 AGTCACACGCAGAAGCTGACTGG - Intergenic
1192989656 X:76436051-76436073 AGTCACACCTACAAGTTAAATGG - Intergenic
1193103185 X:77638840-77638862 ATTCAGACACAGAAGCTAAGAGG - Intronic
1193717527 X:84949891-84949913 AGTCACACCCAGAAGCTGATTGG + Intergenic
1194384583 X:93237065-93237087 AGTCACACCCGGAAGGTGACTGG + Intergenic
1194400765 X:93435876-93435898 AGTCACACCTGGAAGCTGACTGG + Intergenic
1196422808 X:115540293-115540315 AGTCACACCCGGAGGCTGACTGG - Intergenic
1196459878 X:115919000-115919022 AGTCACACCCGGAAGCTGACTGG - Intergenic
1196869610 X:120100183-120100205 AGTCACACCTGGAAGCTGACTGG + Intergenic
1198970272 X:142271357-142271379 AGTCACACCCGGAAGCTGACTGG + Intergenic
1200393874 X:155971508-155971530 AGTCACACCCGGAAGCTGACTGG - Intergenic
1200699364 Y:6389033-6389055 AGTCATACCCAGGAGCTGACTGG + Intergenic
1200912413 Y:8542678-8542700 AGTCACACCCAGTAGCTGACTGG + Intergenic
1200933448 Y:8717607-8717629 AGTCACACCCTGAAGCTGACTGG + Intergenic
1200948483 Y:8868827-8868849 AGTCACTCCCGGAAGCTGGCTGG + Intergenic
1201034747 Y:9775665-9775687 AGTCATACCCAGGAGCTGACTGG - Intergenic
1201270520 Y:12249408-12249430 AGTCACATCCGGAAGCTGACTGG + Intergenic
1201297208 Y:12474212-12474234 AGTCACACCCAGAAGCTGACTGG - Intergenic
1201373046 Y:13286129-13286151 AGTCACACCCGGAAGCTGACTGG + Intronic
1201556529 Y:15268837-15268859 AGTCACACCCAGAAGCTGACTGG + Intergenic
1201680335 Y:16638655-16638677 AGTCACACCCAGAACCGGACTGG - Intergenic
1201697073 Y:16837665-16837687 AGTCACACCTGGAAGCTGACTGG + Intergenic