ID: 1104295480

View in Genome Browser
Species Human (GRCh38)
Location 12:127508100-127508122
Sequence GAGGCCAGGTGCCCGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104295480_1104295493 24 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295493 12:127508147-127508169 TAAAATGGGTAGGAGGATGGAGG No data
1104295480_1104295494 28 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295480_1104295488 10 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295488 12:127508133-127508155 ACTTTCTGAACCTGTAAAATGGG No data
1104295480_1104295489 14 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295489 12:127508137-127508159 TCTGAACCTGTAAAATGGGTAGG No data
1104295480_1104295487 9 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295487 12:127508132-127508154 TACTTTCTGAACCTGTAAAATGG No data
1104295480_1104295490 17 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295490 12:127508140-127508162 GAACCTGTAAAATGGGTAGGAGG No data
1104295480_1104295492 21 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104295480 Original CRISPR GAGGCCAGGTGCCCGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr