ID: 1104295486

View in Genome Browser
Species Human (GRCh38)
Location 12:127508126-127508148
Sequence TACAGGTTCAGAAAGTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104295486_1104295494 2 Left 1104295486 12:127508126-127508148 CCACTTTACTTTCTGAACCTGTA No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295486_1104295493 -2 Left 1104295486 12:127508126-127508148 CCACTTTACTTTCTGAACCTGTA No data
Right 1104295493 12:127508147-127508169 TAAAATGGGTAGGAGGATGGAGG No data
1104295486_1104295492 -5 Left 1104295486 12:127508126-127508148 CCACTTTACTTTCTGAACCTGTA No data
Right 1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG No data
1104295486_1104295490 -9 Left 1104295486 12:127508126-127508148 CCACTTTACTTTCTGAACCTGTA No data
Right 1104295490 12:127508140-127508162 GAACCTGTAAAATGGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104295486 Original CRISPR TACAGGTTCAGAAAGTAAAG TGG (reversed) Intergenic
No off target data available for this crispr