ID: 1104295494

View in Genome Browser
Species Human (GRCh38)
Location 12:127508151-127508173
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104295480_1104295494 28 Left 1104295480 12:127508100-127508122 CCTCCCCACGGGCACCTGGCCTC No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295485_1104295494 9 Left 1104295485 12:127508119-127508141 CCTCTCTCCACTTTACTTTCTGA No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295479_1104295494 29 Left 1104295479 12:127508099-127508121 CCCTCCCCACGGGCACCTGGCCT No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295481_1104295494 25 Left 1104295481 12:127508103-127508125 CCCCACGGGCACCTGGCCTCTCT No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295482_1104295494 24 Left 1104295482 12:127508104-127508126 CCCACGGGCACCTGGCCTCTCTC No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295483_1104295494 23 Left 1104295483 12:127508105-127508127 CCACGGGCACCTGGCCTCTCTCC No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295486_1104295494 2 Left 1104295486 12:127508126-127508148 CCACTTTACTTTCTGAACCTGTA No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data
1104295484_1104295494 14 Left 1104295484 12:127508114-127508136 CCTGGCCTCTCTCCACTTTACTT No data
Right 1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104295494 Original CRISPR ATGGGTAGGAGGATGGAGGA TGG Intergenic
No off target data available for this crispr