ID: 1104304330

View in Genome Browser
Species Human (GRCh38)
Location 12:127595629-127595651
Sequence GAACTCTGGATTGCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104304325_1104304330 17 Left 1104304325 12:127595589-127595611 CCAAATAAAGTTCTCTTTGAAAT No data
Right 1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG No data
1104304324_1104304330 18 Left 1104304324 12:127595588-127595610 CCCAAATAAAGTTCTCTTTGAAA No data
Right 1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104304330 Original CRISPR GAACTCTGGATTGCAGCAGC TGG Intergenic
No off target data available for this crispr