ID: 1104311121

View in Genome Browser
Species Human (GRCh38)
Location 12:127655149-127655171
Sequence CCGGCTGCCCGGGAGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104311121_1104311130 13 Left 1104311121 12:127655149-127655171 CCACGCTCCTCCCGGGCAGCCGG No data
Right 1104311130 12:127655185-127655207 AAAGCGCTGCAGAGATGTTGGGG No data
1104311121_1104311129 12 Left 1104311121 12:127655149-127655171 CCACGCTCCTCCCGGGCAGCCGG No data
Right 1104311129 12:127655184-127655206 CAAAGCGCTGCAGAGATGTTGGG No data
1104311121_1104311128 11 Left 1104311121 12:127655149-127655171 CCACGCTCCTCCCGGGCAGCCGG No data
Right 1104311128 12:127655183-127655205 GCAAAGCGCTGCAGAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104311121 Original CRISPR CCGGCTGCCCGGGAGGAGCG TGG (reversed) Intergenic
No off target data available for this crispr