ID: 1104322844

View in Genome Browser
Species Human (GRCh38)
Location 12:127768209-127768231
Sequence CAAGTGTCTGCACTTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104322844_1104322852 28 Left 1104322844 12:127768209-127768231 CCCCCACCAAGTGCAGACACTTG No data
Right 1104322852 12:127768260-127768282 CTTCACAAGAGAGAAATTGCAGG No data
1104322844_1104322849 -8 Left 1104322844 12:127768209-127768231 CCCCCACCAAGTGCAGACACTTG No data
Right 1104322849 12:127768224-127768246 GACACTTGAGAGTCATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104322844 Original CRISPR CAAGTGTCTGCACTTGGTGG GGG (reversed) Intergenic
No off target data available for this crispr