ID: 1104332136

View in Genome Browser
Species Human (GRCh38)
Location 12:127856818-127856840
Sequence CTGGGAAAACACAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104332129_1104332136 26 Left 1104332129 12:127856769-127856791 CCAAGGGGAATCAATTGCTCAGA No data
Right 1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104332136 Original CRISPR CTGGGAAAACACAAGGAGGG AGG Intergenic
No off target data available for this crispr