ID: 1104337589

View in Genome Browser
Species Human (GRCh38)
Location 12:127914313-127914335
Sequence TGCTTGCCAAGTTGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104337584_1104337589 27 Left 1104337584 12:127914263-127914285 CCTTGTATCTTTCATTTTCTTAT No data
Right 1104337589 12:127914313-127914335 TGCTTGCCAAGTTGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104337589 Original CRISPR TGCTTGCCAAGTTGTGAGGG AGG Intergenic
No off target data available for this crispr