ID: 1104341158

View in Genome Browser
Species Human (GRCh38)
Location 12:127950233-127950255
Sequence AGGATGTAGGTGGATATTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104341158 Original CRISPR AGGATGTAGGTGGATATTGA CGG Intergenic
905375512 1:37517666-37517688 AGGATGTATGGTGATATTGGTGG - Intergenic
906099266 1:43247373-43247395 AGGATGTATGGTGATATTGGTGG - Intronic
906101112 1:43262888-43262910 AGGATGTATGGTGATATTGGTGG - Intronic
908583070 1:65538311-65538333 AGGAGGAAGGTGGAGATGGAAGG - Intronic
908835529 1:68225754-68225776 AGGGTGTAGGTTGGTAGTGATGG - Intronic
913063001 1:115225077-115225099 AGGCTTTGGGTGGGTATTGATGG + Intergenic
913680265 1:121183753-121183775 AGGAGGCAGGTGGAGTTTGAAGG + Exonic
914032100 1:143971404-143971426 AGGAGGCAGGTGGAGTTTGAAGG + Exonic
914157345 1:145096563-145096585 AGGAGGCAGGTGGAGTTTGAAGG - Exonic
916355551 1:163902797-163902819 TGGATGTTGATGGATCTTGATGG + Intergenic
917461955 1:175239087-175239109 AGAATGATGGTGGATTTTGATGG - Intergenic
919499314 1:198315926-198315948 AGCATGTTGGTGGTTATTGAAGG + Intronic
920312244 1:205055394-205055416 AGGGTGTCTGTGGATATGGATGG + Intronic
920467577 1:206202288-206202310 AGGAGGCAGGTGGAGTTTGAAGG + Exonic
921505877 1:215969389-215969411 AGGATGCAGGTTGATAATGCAGG + Intronic
921907246 1:220508221-220508243 AGGAAGGAGTTGGATATTTAAGG + Intergenic
922085046 1:222338497-222338519 AGGGTGTGGGTGGATATAAAGGG - Intergenic
922157183 1:223049593-223049615 TGGGTGTAGGTGGAAAGTGAGGG + Intergenic
922580753 1:226695993-226696015 AGCATGTAAGTGAATATTGGAGG - Intronic
922751504 1:228072212-228072234 AGAGTGTAGGTGGATAGTGAAGG + Intergenic
922751522 1:228072328-228072350 ATAGTGTAGGTGGATAGTGAAGG + Intergenic
923433331 1:233945443-233945465 AGGATGTGTCTGGTTATTGAAGG + Intronic
923556880 1:235008058-235008080 AAGATGGAGGTGGAGATTGGAGG - Intergenic
923824437 1:237484269-237484291 AAGATGTATGTGGATTTAGATGG - Intronic
924816506 1:247446578-247446600 ATAATGCAGGTGGATACTGAAGG - Intronic
1065289036 10:24211813-24211835 AGATTCTAGGTGTATATTGAAGG + Intronic
1066115749 10:32237991-32238013 AGTATGGAAGTGTATATTGAAGG + Intergenic
1070163684 10:73881828-73881850 AGGATGTTGGTGGATAGAGGTGG + Intergenic
1070287205 10:75092774-75092796 AGGCTGCAGGGGGAGATTGAAGG - Intergenic
1075669021 10:124250445-124250467 AGGCTGTAGTCTGATATTGATGG - Intergenic
1075786755 10:125055217-125055239 AGCATGTAGGTAAATATTGAAGG + Intronic
1076379203 10:130013883-130013905 AGGATGCAGGAGGTTAGTGAGGG + Intergenic
1078440080 11:11357456-11357478 AGGGAGTGGGTGGAGATTGATGG - Intronic
1079048705 11:17133335-17133357 TGGATTTAAATGGATATTGATGG - Intronic
1081001957 11:37685257-37685279 AGGATTTATTTGGATATTTAGGG - Intergenic
1081206448 11:40281035-40281057 AGGATGAAGGCGGATAGGGATGG + Intronic
1082778322 11:57265554-57265576 AGGATGTATGTTGATATTAGTGG + Intergenic
1085526247 11:77165954-77165976 TGGAACTAGGTGGATTTTGAGGG + Intronic
1086590662 11:88510276-88510298 AGGATCCTGGTGAATATTGAGGG + Intronic
1087029536 11:93689073-93689095 AGGATGTAGGTGGAAAGAAATGG - Intronic
1090414279 11:126529932-126529954 TGGATGAAGGTGGAGATGGAGGG + Intronic
1091045028 11:132317797-132317819 AGGATGTGGAAGGCTATTGAAGG + Intronic
1092973961 12:13726021-13726043 TGGATGTAGGTAGAAATTCATGG - Intronic
1093304893 12:17503388-17503410 ATGATGAAGGTGGGTAGTGATGG + Intergenic
1095837507 12:46654624-46654646 AGAATTCAGGTGCATATTGAGGG + Intergenic
1097874651 12:64632104-64632126 TGGTGGCAGGTGGATATTGATGG + Intronic
1098039564 12:66340524-66340546 AGGATATATGTGGATATAAAAGG + Exonic
1099047272 12:77737231-77737253 AGGATGCAGGTGAAGACTGAGGG + Intergenic
1100977200 12:100134855-100134877 AGGTTCTAGGTGTATTTTGAAGG - Intronic
1101968989 12:109299623-109299645 AGGAAGTAGGGGGATGCTGAAGG + Intronic
1103948911 12:124541211-124541233 GGGATGGAGGTGGAGATGGAGGG + Intronic
1103949097 12:124541763-124541785 GGGATGGGGGTGGATATGGAGGG + Intronic
1103949107 12:124541785-124541807 GGGATGGGGGTGGATATGGAGGG + Intronic
1104341158 12:127950233-127950255 AGGATGTAGGTGGATATTGACGG + Intergenic
1104706004 12:130948040-130948062 ATGATTTAGGTGGTTAGTGAAGG + Intergenic
1115245289 14:31288129-31288151 AGGATGTCAGTGCATATAGAAGG - Intergenic
1115404404 14:32998622-32998644 AGGTTGCAGGTGGATTGTGAAGG - Intronic
1116134707 14:40907669-40907691 AGGAGAGAGGTGGAGATTGAAGG + Intergenic
1116977268 14:51130392-51130414 GGGATGCAGATGGATAGTGAAGG - Intergenic
1118161311 14:63293369-63293391 AGGAAGTAAGTTGATCTTGATGG + Intergenic
1119597915 14:75953644-75953666 AGCATATAGGTGTATATTGTTGG + Intronic
1119889679 14:78173538-78173560 AGGATGGAGGGGGAGATTGGTGG - Intergenic
1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG + Intronic
1125377586 15:39047633-39047655 AGGATGCAGGAGGAAATTTATGG + Intergenic
1126020650 15:44397724-44397746 AGAATGTAGGTGCAAAGTGAGGG - Intronic
1127988258 15:64092177-64092199 GGGATGCAGTTGGATACTGAAGG - Intronic
1129504649 15:76071362-76071384 AGGCTGTAGGTGGGTAATGGTGG - Intronic
1130423835 15:83775407-83775429 AGGATGAAAGTGGTTATTCATGG - Intronic
1131994219 15:98118957-98118979 AGGATGTAGGAGAATATGTATGG - Intergenic
1132467207 16:82864-82886 AGGCTGAATGTGGCTATTGAGGG - Intronic
1133256319 16:4518552-4518574 AGGACGCATGTGGATATGGAGGG - Intronic
1135921965 16:26658686-26658708 AGGATGCACGTGGCTATAGAGGG - Intergenic
1139484853 16:67249564-67249586 AGGATGTGTGGGGACATTGAGGG + Intronic
1141361868 16:83402938-83402960 AGATTGTAGCTGGTTATTGATGG - Intronic
1141933619 16:87221689-87221711 TGGATGACGGTGGATAATGATGG - Intronic
1203052180 16_KI270728v1_random:886203-886225 AGGTTCTATGTGGATTTTGAAGG + Intergenic
1143055304 17:4157917-4157939 AGGAAGCTGGTGGATGTTGAGGG - Intronic
1143171122 17:4931139-4931161 AGGTTGTAGGTGGTGGTTGAAGG + Intergenic
1143803472 17:9404957-9404979 GGGATGTGGGTGGAGGTTGAAGG - Intronic
1143867373 17:9933926-9933948 ATGCTCTTGGTGGATATTGATGG + Intronic
1146044400 17:29491829-29491851 CTGATGTAGGTCGATCTTGAGGG - Exonic
1146486011 17:33243146-33243168 AGGATGAAGTTGTACATTGATGG + Intronic
1151499360 17:74479056-74479078 AGGATGTATGTGATTATTGTAGG + Intronic
1153181440 18:2439402-2439424 ATCATGTTGGTGGTTATTGAAGG + Intergenic
1155743477 18:29319933-29319955 AGGATGTAGGAGTAAAGTGATGG + Intergenic
1156103698 18:33630481-33630503 AGAATATAGGTGGATAAAGAAGG + Intronic
1156727866 18:40150958-40150980 AAGATGTAGGTGGAGAGTGTTGG - Intergenic
1156912578 18:42427990-42428012 AGGAGGCAAGTGGATATTCAAGG - Intergenic
1157776153 18:50397835-50397857 ATGATGTATTTGGATGTTGATGG + Intergenic
1158098270 18:53800110-53800132 AGGATATAGAAGGATATGGAAGG - Intergenic
1160389278 18:78518084-78518106 AGGATGGAGGCGGACATTGCAGG + Intergenic
1166024352 19:40067309-40067331 AGGATGTAAGTGAATATTTTTGG - Intergenic
926119930 2:10236322-10236344 AGGATGGGGGTGGATACAGATGG - Intergenic
929918385 2:46154771-46154793 AGGATAAAGGTGGATAGGGAAGG - Intronic
929996552 2:46829628-46829650 GGGATGTGGGTGGTGATTGAAGG - Intronic
930638061 2:53827781-53827803 TGAATAAAGGTGGATATTGAGGG - Intergenic
933289394 2:80420991-80421013 AGCATGTAGGTGGAATGTGAAGG - Intronic
934926420 2:98384787-98384809 AGGATGTGGGTGGATAGCGTGGG + Intronic
936776313 2:115977730-115977752 CGGATCCAGGTGGATATAGATGG + Intergenic
937766009 2:125661214-125661236 AGGAAGGAGATGGATATGGAGGG + Intergenic
941215999 2:162709959-162709981 AGGATGAGAGTAGATATTGAAGG + Intronic
942677406 2:178442474-178442496 AGCATGGAGGTAGATATTTATGG - Intronic
947030614 2:225788828-225788850 AGGATGTATGTGTATATGAAAGG - Intergenic
947124122 2:226849513-226849535 GGGATGTAGGTGGAGCCTGAGGG - Intronic
947321436 2:228923731-228923753 AGGATTTAGCTGTATTTTGAAGG + Intronic
948042067 2:234910358-234910380 AGGAAGTAGATGGTTATTCATGG - Intergenic
1170391896 20:15884280-15884302 AGGATGAAGGTGAATAGAGAGGG + Intronic
1172969088 20:38860542-38860564 AGGTTGGAGGTGGAGATTGCAGG + Intronic
1173382258 20:42556437-42556459 ATGAAGTAAGTGGATATTGGCGG + Intronic
1174416240 20:50369215-50369237 TGGATGTTGGTGGACACTGATGG + Intergenic
1175574482 20:60050519-60050541 AGGGAGTTGGTGGATATTGCAGG + Intergenic
1176065617 20:63192929-63192951 AGGATGGAGACGGATACTGAGGG + Intergenic
1178234880 21:30829716-30829738 AGGATTTAGATGGATTGTGAAGG + Exonic
1179474993 21:41637334-41637356 AGGATCGAGGTGGACAGTGAGGG - Intergenic
1179590839 21:42406887-42406909 AGGATGTTTGTGTTTATTGATGG + Intronic
1180722221 22:17917836-17917858 AGGATGTGGGTCGAGAGTGACGG - Intronic
1181435518 22:22908208-22908230 AGGGTGTAGGTGCACATGGAGGG - Intergenic
1182416735 22:30226127-30226149 AGGAGGTAGGTGTATCTTGGAGG + Intergenic
1182835871 22:33340977-33340999 AGGTAGTAGGGGGCTATTGAGGG - Intronic
1184997535 22:48219910-48219932 ACAATGTGGGTGGAGATTGAGGG - Intergenic
949818298 3:8086314-8086336 AGGATTTAGATAGATGTTGAGGG + Intergenic
951982052 3:28576281-28576303 AAGATGGAGATGGATGTTGAGGG + Intergenic
953582174 3:44167123-44167145 GGGATGGAGGTGGATTTTGAAGG + Intergenic
955488070 3:59454776-59454798 AGGATGTATGTGCATACAGAGGG - Intergenic
956329400 3:68088934-68088956 AGGATGTAGGGGGAGAGGGAAGG + Intronic
956989717 3:74749528-74749550 AGAACGGAGGTGGAAATTGAAGG + Intergenic
957442350 3:80265828-80265850 AGGGTGGAGGTGGAAATGGAAGG + Intergenic
958724713 3:97890450-97890472 AGGTTGTAGGTGTATATGAATGG + Intronic
959130861 3:102354497-102354519 GGGATGGAGGTGGATATGTATGG + Intronic
960141563 3:114156227-114156249 GGGATGTAGTTGGAGATTTAGGG - Intronic
961226103 3:125248316-125248338 AGGAGGTAGCTGGAAATTGGGGG - Intronic
962968914 3:140380854-140380876 AGGACCAAGGTGGATCTTGAAGG + Intronic
963348734 3:144127098-144127120 AGGATGTGGATGTATTTTGAAGG + Intergenic
964172639 3:153789398-153789420 AGGAGGTAAGTGGTTATGGAGGG - Intergenic
964311713 3:155400821-155400843 ATGATGGAGGTTGATACTGAAGG - Intronic
965630160 3:170724887-170724909 AGGATGTAAGTGGAGGCTGAGGG - Intronic
966923300 3:184628596-184628618 AGGCTGCAGGTGGCTATGGAAGG - Intronic
966993556 3:185258002-185258024 AGGATGTATGATGATATTGGTGG - Intronic
969609054 4:8216927-8216949 AGGATGGAGGTGGTCACTGAGGG - Intronic
970074267 4:12199450-12199472 AGGATGTGGGTGGATAACTAAGG + Intergenic
970638638 4:18038358-18038380 AGGATGTATGTGGTGAGTGAGGG + Intergenic
970979778 4:22082736-22082758 AGGAAGTAGGTGGAGACAGAGGG - Intergenic
975423072 4:74191876-74191898 AGGATGTTAGAGGATATGGAAGG + Intronic
981946016 4:150345049-150345071 AGGCTGGAGTTGCATATTGAAGG - Intronic
982055700 4:151546891-151546913 AAGAGGTAGGGGGAGATTGAAGG + Intronic
983528341 4:168783823-168783845 ATGATGTAGCTGTATAGTGAGGG + Intronic
986650587 5:9959672-9959694 AAGGGGTAGGTGAATATTGAGGG - Intergenic
987255366 5:16144944-16144966 AGGTTGTAGGTGGAGTTTGTGGG + Intronic
990270784 5:54136278-54136300 ATGATGTAGCTGGCTATTGAAGG - Intronic
991726530 5:69541204-69541226 TGGGTGTGGGTGGGTATTGATGG - Intronic
991868427 5:71086670-71086692 TGGGTGTGGGTGGGTATTGATGG + Intergenic
992115444 5:73534652-73534674 AGGCTGTTGGTGGATATCCATGG + Intergenic
993062468 5:83055198-83055220 AGGAGGTAGGTGGAAAGTAAAGG - Exonic
993604074 5:89966110-89966132 TTGATGTTGGTGGATAATGAAGG - Intergenic
997211430 5:132079292-132079314 AGGGTGTGGGTGGGTATTGGGGG + Intergenic
997602633 5:135150771-135150793 AGGCTGTAAGGTGATATTGATGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999074803 5:148784265-148784287 GGGATGCATGTGAATATTGAGGG - Intergenic
999719643 5:154389919-154389941 AGGATGCAGGGGGTTTTTGATGG - Intronic
1001761247 5:174210115-174210137 AGCATCCAGGTGGATCTTGAAGG - Intronic
1007090092 6:39178687-39178709 GGGATGTTGTTGGATATTGGGGG + Intergenic
1008975313 6:57419220-57419242 AGGATCTTGGTGGCCATTGATGG + Intronic
1009164192 6:60320733-60320755 AGGATCTTGGTGGCCATTGATGG + Intergenic
1016128654 6:140437659-140437681 GGGATGAAGGTGGAAATTGGTGG - Intergenic
1016196852 6:141354360-141354382 AGGATTTAGGTGGAGCTAGATGG + Intergenic
1017509000 6:155095445-155095467 AGGATGTGTGTTGATAATGATGG + Intronic
1020765130 7:12310386-12310408 TGGATGTAGCTAGATATTGGAGG - Intergenic
1023760418 7:43460665-43460687 AAAATGGAGGAGGATATTGATGG + Intronic
1025226011 7:57163934-57163956 AAGATGTGAGTGGATATTAATGG + Intergenic
1026192572 7:68142882-68142904 TGGATGTGGCTGGATATGGATGG + Intergenic
1028590480 7:92488161-92488183 AGGATGTATGTGGATAAAGGGGG + Intronic
1030144133 7:106335408-106335430 AGGATGTATGGTGATATTGGTGG + Intergenic
1030688680 7:112510981-112511003 ATGATGTGGGTGGAGATGGATGG + Intergenic
1030944234 7:115696278-115696300 AGGATGTAGGTGTACAGTGTAGG + Intergenic
1032415304 7:131730988-131731010 AGAATCAAGGTGGATATGGAGGG - Intergenic
1032443748 7:131962299-131962321 GGGTTGATGGTGGATATTGATGG + Intergenic
1033487251 7:141803034-141803056 AGGATGTTCGTGTTTATTGATGG + Intergenic
1035851273 8:2921589-2921611 AGTGAGTTGGTGGATATTGAAGG + Intergenic
1036506028 8:9356838-9356860 AGGATGTAGGTGCATATAAAAGG - Intergenic
1037070330 8:14638499-14638521 AGGAGGTAAGGAGATATTGATGG - Intronic
1037243705 8:16806746-16806768 AAGAGGTAGGCAGATATTGAGGG + Intergenic
1039511148 8:38092950-38092972 ATGATATAGGTAGATAGTGAGGG - Intergenic
1040682626 8:49831737-49831759 AGGATGTATGGTGATATTGGTGG + Intergenic
1041752498 8:61276235-61276257 CTAATGTGGGTGGATATTGATGG - Intronic
1042179808 8:66075746-66075768 AGGAAGTAGATGAATATTTAAGG - Intronic
1043414810 8:80036108-80036130 TGGATGAAGGTGGGTATTGGGGG - Intronic
1046088558 8:109469396-109469418 GGAATGTAGGGGGATATTGGTGG - Intronic
1046850998 8:118972711-118972733 AGAAGGTAGATGGATATTAAAGG - Intergenic
1046868752 8:119180633-119180655 AGGATGGAGCTGGATGTTGCAGG - Intronic
1047056911 8:121175228-121175250 AGGATAAAGGTGGAAATGGAAGG - Intergenic
1048940651 8:139397768-139397790 AGGAGCAAGCTGGATATTGAAGG - Intergenic
1050089813 9:2006242-2006264 AGGATGTATGTGAATCTTGCGGG + Intergenic
1052823051 9:33154598-33154620 GTGATGTAGGTGGTTGTTGATGG + Intronic
1053234665 9:36442260-36442282 AGGCTTGAGTTGGATATTGAGGG - Intronic
1055416016 9:76084088-76084110 AGGATGTAGTTAAATCTTGAGGG - Intronic
1055994158 9:82139545-82139567 AGGATGTAGCTGATTATTTAAGG + Intergenic
1056319399 9:85422090-85422112 AGGTGGTAGGTGGGTATTGGGGG + Intergenic
1057678894 9:97157387-97157409 AGGATTTTGGTAGAGATTGAAGG - Intergenic
1059206213 9:112468647-112468669 AGGATGCAGGTGGAGAAAGAGGG - Intronic
1059413973 9:114151925-114151947 ATTATGTATGTGAATATTGAGGG - Intergenic
1060260834 9:122072308-122072330 AGGATGTGGGAGGAGAGTGAAGG - Intronic
1188491221 X:30740567-30740589 AGTACTTAGGTGGATAGTGAGGG + Intergenic
1191868728 X:65727300-65727322 AGGCTGAAGGTGGAGATTGTTGG - Intronic
1192054760 X:67761663-67761685 AGAAGTTAGGTGGATCTTGAAGG - Intergenic
1192095529 X:68206813-68206835 AGTAGGTAGGTGGCTATGGAAGG - Intronic
1194244141 X:91490819-91490841 AGGATGCCGTTGTATATTGAGGG - Intergenic
1195165894 X:102220120-102220142 AGGATGTAGGAGGAGAAAGAAGG + Intronic
1195192965 X:102466971-102466993 AGGATGTAGGAGGAGAAAGAAGG - Intronic
1195672051 X:107477966-107477988 AGGATCTAGGTGGGTCTTGAAGG - Intergenic
1196495098 X:116315786-116315808 AGTAAGTAGTTGGATATTAAAGG - Intergenic
1196700179 X:118659546-118659568 GTGATGTAATTGGATATTGATGG + Intronic
1197525150 X:127552373-127552395 AGACTGTAGGTGTATATAGAAGG + Intergenic
1199435782 X:147811061-147811083 AGTATGTAGGTGAATAGTGACGG - Intergenic
1199487353 X:148362646-148362668 AGCAGGTAGTTGAATATTGAAGG + Intergenic