ID: 1104342387

View in Genome Browser
Species Human (GRCh38)
Location 12:127962920-127962942
Sequence AAAGTCCTTGTGGAGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104342387_1104342392 30 Left 1104342387 12:127962920-127962942 CCACCAGCCTCCACAAGGACTTT No data
Right 1104342392 12:127962973-127962995 CTCACAGTGCCCTCTACCCAGGG No data
1104342387_1104342391 29 Left 1104342387 12:127962920-127962942 CCACCAGCCTCCACAAGGACTTT No data
Right 1104342391 12:127962972-127962994 ACTCACAGTGCCCTCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104342387 Original CRISPR AAAGTCCTTGTGGAGGCTGG TGG (reversed) Intergenic
No off target data available for this crispr