ID: 1104349837

View in Genome Browser
Species Human (GRCh38)
Location 12:128035643-128035665
Sequence GACCCACTGAGGGTTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104349837_1104349840 -4 Left 1104349837 12:128035643-128035665 CCAGGGGGAACCCTCAGTGGGTC No data
Right 1104349840 12:128035662-128035684 GGTCCCAAAAGAAAGCTGCATGG No data
1104349837_1104349843 5 Left 1104349837 12:128035643-128035665 CCAGGGGGAACCCTCAGTGGGTC No data
Right 1104349843 12:128035671-128035693 AGAAAGCTGCATGGAGTGAAAGG No data
1104349837_1104349844 25 Left 1104349837 12:128035643-128035665 CCAGGGGGAACCCTCAGTGGGTC No data
Right 1104349844 12:128035691-128035713 AGGATCAAGAAAATGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104349837 Original CRISPR GACCCACTGAGGGTTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr