ID: 1104351195

View in Genome Browser
Species Human (GRCh38)
Location 12:128045411-128045433
Sequence CGAGCTGCAGACATAGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104351195_1104351197 6 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351197 12:128045440-128045462 CAGGCTGCTGTTTGTTAGAAAGG 0: 6
1: 33
2: 39
3: 93
4: 317
1104351195_1104351200 20 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351200 12:128045454-128045476 TTAGAAAGGAAAATAACTTGGGG No data
1104351195_1104351198 18 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351198 12:128045452-128045474 TGTTAGAAAGGAAAATAACTTGG No data
1104351195_1104351199 19 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351199 12:128045453-128045475 GTTAGAAAGGAAAATAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104351195 Original CRISPR CGAGCTGCAGACATAGATAT TGG (reversed) Intergenic
No off target data available for this crispr