ID: 1104351197

View in Genome Browser
Species Human (GRCh38)
Location 12:128045440-128045462
Sequence CAGGCTGCTGTTTGTTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 6, 1: 33, 2: 39, 3: 93, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104351195_1104351197 6 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351197 12:128045440-128045462 CAGGCTGCTGTTTGTTAGAAAGG 0: 6
1: 33
2: 39
3: 93
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104351197 Original CRISPR CAGGCTGCTGTTTGTTAGAA AGG Intergenic
905176206 1:36137047-36137069 CAGTCTGCTCTTTATTTGAATGG + Exonic
906743989 1:48208752-48208774 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
907109672 1:51915419-51915441 CAGGCTCCTATTTTATAGAAGGG - Exonic
909103165 1:71376465-71376487 CAGGCTGCTCTTCATTAGAAAGG + Intergenic
909374554 1:74924533-74924555 CTGGCTGCTTTTTGGTAGAGCGG - Intergenic
910070631 1:83208962-83208984 GGGGCTGCTTTTTGTTAAAAAGG + Intergenic
910189714 1:84583212-84583234 CAGGCTGCTGTTTGTTAGAAAGG - Intergenic
910245349 1:85132741-85132763 CTGGCTGCTGTTTTCTGGAAAGG - Intronic
910777093 1:90887747-90887769 TAGGCTGCTGTTTGTCTGATTGG - Intergenic
911957849 1:104260935-104260957 CGGGCTGTTTTTTGTTAAAAGGG - Intergenic
911976487 1:104503104-104503126 AGGGCTGCTTTTTGTTAAAAGGG + Intergenic
912976861 1:114338871-114338893 CAGGCTGCTCTTTGTTAGAAGGG + Intergenic
914994876 1:152534827-152534849 GAGGCTGCTTTTTGTTAAAAGGG - Intronic
915133268 1:153711382-153711404 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
915812277 1:158926448-158926470 TGGGCTTCTTTTTGTTAGAAGGG - Intergenic
915926291 1:160022389-160022411 CAGGATGCTTTTTTTCAGAATGG + Intergenic
916333560 1:163645224-163645246 GAGGGTCCTGTCTGTTAGAAGGG - Intergenic
916336053 1:163672367-163672389 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
918685933 1:187415870-187415892 GGGGATGCTTTTTGTTAGAAGGG - Intergenic
918702791 1:187626473-187626495 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
919480312 1:198079883-198079905 CAGGCTGTTCTTTGTTAGAGAGG + Intergenic
919905915 1:202078238-202078260 CCTGCTGCTGTTTATTTGAAGGG + Intergenic
920363244 1:205433823-205433845 CAGGCAGCTGTTGTTTAGAGCGG - Intronic
920683327 1:208090007-208090029 CTGGCTGCTGTTTGCTGAAAAGG + Intronic
921581038 1:216896870-216896892 TACGCTGCTGCTTGTTAAAAAGG - Intronic
922155210 1:223035718-223035740 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
922695215 1:227728080-227728102 CAGGCTGCTGTCTGTTCAGAAGG - Intergenic
923032156 1:230257747-230257769 CAGGCAGCTGTTTGCTAATAGGG + Intronic
923232384 1:231999447-231999469 CTGGCTGCTTATTGTTAGCAGGG - Intronic
923888463 1:238183851-238183873 TGGGCTGGTTTTTGTTAGAAGGG + Intergenic
924274227 1:242368866-242368888 TGGGTTGCTTTTTGTTAGAAAGG + Intronic
924474344 1:244370070-244370092 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
924814263 1:247428359-247428381 CAGGCTTCTGGTTCTCAGAAGGG - Intronic
1063795582 10:9511017-9511039 CAGCCTGCTATCTGTTAGAAAGG + Intergenic
1063820170 10:9825532-9825554 CAGGCTGTTCTTTGTTCTAAAGG - Intergenic
1064137938 10:12766609-12766631 TGGGCTGCTTTTTGTTAGAAGGG + Intronic
1064160720 10:12943427-12943449 CAGGCTGCTTTTTGTTAAAAGGG - Intronic
1064321612 10:14310393-14310415 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
1064564237 10:16624032-16624054 CAGTCTTCTGTTTGTAAAAAGGG + Intronic
1064773802 10:18753136-18753158 GGGGCTGCTTTTTGTTAAAAAGG - Intergenic
1064803161 10:19099253-19099275 TGGGCTGCTTTTTGGTAGAAGGG + Intronic
1065443750 10:25776227-25776249 GGAGCTGCTCTTTGTTAGAAGGG + Intergenic
1065939582 10:30552232-30552254 CAGGCTGCTCTTCATTAGAAAGG - Intergenic
1066618531 10:37320843-37320865 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
1067766211 10:49089404-49089426 AAGGCACCTGTTGGTTAGAATGG - Intronic
1068306216 10:55211911-55211933 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
1068505824 10:57898133-57898155 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1068505830 10:57898167-57898189 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1071559976 10:86638138-86638160 AAGGCTGCTGTTTTTCAGCATGG + Intergenic
1073423033 10:103439815-103439837 CAGGGAGGTGTTTGTTATAAAGG - Exonic
1074042105 10:109800738-109800760 GAGGGTCCTGTCTGTTAGAAGGG - Intergenic
1074886861 10:117700775-117700797 GCGGCTGCTGTCTGTTGGAAGGG - Intergenic
1074967362 10:118503192-118503214 CAGGCAGCAGTTTGTCAGAATGG - Intergenic
1075031736 10:119029100-119029122 CATGCTGATGTTGGTGAGAAGGG + Intergenic
1075748730 10:124745991-124746013 CAGGCTGCTTTAGGTTGGAAAGG - Intronic
1076446654 10:130518803-130518825 CACGCTGCTCTTTGTTAGAAAGG - Intergenic
1076783055 10:132735081-132735103 CATGCTGCTGTTTGACAGAAAGG - Intronic
1077835054 11:5919250-5919272 GAGGGTCCTGTCTGTTAGAAGGG + Intronic
1078179418 11:8998410-8998432 GAGGCTGCATTTTGTTAGAAAGG + Intronic
1078595065 11:12678956-12678978 CAGGATGATGTTTCTTACAAGGG + Intronic
1079849292 11:25510709-25510731 CAGGCTGCTGGTTCATAGACAGG - Intergenic
1080082473 11:28237811-28237833 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
1080270573 11:30447116-30447138 CAGGCGGCTGTTTGTCAGGTGGG + Intronic
1080270743 11:30448444-30448466 CAGGCTTCTGATTGTTACACGGG + Intronic
1081014423 11:37858068-37858090 CAAGCTGCTCTTTGCTAGAGAGG + Intergenic
1082185632 11:49177523-49177545 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
1083084675 11:60130307-60130329 GGGGCTGCTTTTTGTTAAAAAGG + Intergenic
1084345840 11:68548263-68548285 CAGGCTGCTGTGTGCTGGGAAGG + Intronic
1084788382 11:71457403-71457425 CAGGCTGATGTGTAGTAGAAAGG + Intronic
1085590072 11:77752129-77752151 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
1086436885 11:86790649-86790671 CACCCTGCTGTTTGATGGAATGG + Intergenic
1086680696 11:89667813-89667835 TGGGCTGCTTTTTGTTAGAAGGG + Intergenic
1087424984 11:97973774-97973796 GAGGCTGCTTTTTGTTAGAAGGG + Intergenic
1087524084 11:99285486-99285508 TAGGGTGCTGTTTTTTAAAATGG + Intronic
1087591670 11:100197029-100197051 CATTCAGCTGTTTGTTAGAAGGG + Intronic
1087742826 11:101909831-101909853 CAGGCTGCAGTTTGCTACAGAGG - Intronic
1087931084 11:103978407-103978429 TAGAATGCTGTTTGTTTGAAGGG + Intronic
1087942880 11:104122079-104122101 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
1088502167 11:110493408-110493430 TGGGCTGCTTTTTGTTAGAAGGG + Intergenic
1089474555 11:118748134-118748156 CAGGCTGCTGTATTTTACATTGG - Exonic
1089713458 11:120335153-120335175 CACGCTGACGTTAGTTAGAACGG - Intergenic
1090947749 11:131447081-131447103 AAGGCTGCTGCTTATTAGCATGG + Intronic
1091363161 11:134994215-134994237 TGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1091504835 12:1056865-1056887 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
1092300304 12:7242220-7242242 TGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1092536044 12:9388235-9388257 TGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1092562767 12:9633648-9633670 TGGGCTGCTTTTTGTTAAAATGG + Intergenic
1092636600 12:10457693-10457715 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1093074507 12:14743662-14743684 CTGGCTGCTCCTTATTAGAAGGG + Intergenic
1093188527 12:16049339-16049361 GGGGCTGCTTATTGTTAGAAGGG - Intergenic
1093207050 12:16263770-16263792 CAGGCTGCTGTTTCAGAGGATGG + Intronic
1093741561 12:22694523-22694545 CAGGCTGCTCTTTGTTAGAAGGG - Intergenic
1093923731 12:24888813-24888835 CAGGCTGCTCTTCTTTAGAAAGG - Intronic
1095251023 12:39979106-39979128 GAGGGTCCTGTCTGTTAGAAGGG + Intronic
1097489182 12:60242675-60242697 GGGGCTTCTTTTTGTTAGAAGGG + Intergenic
1097515830 12:60604453-60604475 ACTGCTGCTGTTTGTCAGAATGG - Intergenic
1098292111 12:68966334-68966356 CAGTCTGCTGTTGGTAACAATGG - Intronic
1098433126 12:70441842-70441864 TATACTGCTGTTTGTTAAAATGG - Intergenic
1098720294 12:73888987-73889009 CAGGCTGCTCTTTCTTAGAAAGG + Intergenic
1099250594 12:80249373-80249395 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
1099283526 12:80684567-80684589 GGGGCTGCTTTTTATTAGAAGGG + Intergenic
1099597804 12:84690127-84690149 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1099629330 12:85120791-85120813 CAGGCTGCTGATAGTTACAGGGG - Intronic
1099979599 12:89583287-89583309 CAAGCTGCTTCTTTTTAGAAGGG + Intergenic
1100111819 12:91254606-91254628 CAGCCTGATATTTTTTAGAAAGG - Intergenic
1100397916 12:94200695-94200717 CATGCTGCTGTTTTTTTAAATGG + Intronic
1100603415 12:96131657-96131679 CAGGCTGCTCTTTGTTAAAAAGG + Intergenic
1101664242 12:106795720-106795742 CAGGCTGCTCTTTGTTAGAAAGG + Intronic
1101736522 12:107467328-107467350 ACGGCTGCTGCTTGTTGGAACGG - Intronic
1101863873 12:108505155-108505177 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1102987429 12:117290001-117290023 CTGGCTGCTTGTTGTTAGAAGGG + Intronic
1103236627 12:119378361-119378383 CAGGCTTCTCTTTGTTAGAAAGG + Intronic
1104351197 12:128045440-128045462 CAGGCTGCTGTTTGTTAGAAAGG + Intergenic
1104400827 12:128474848-128474870 CAAGCTGCTGTTTTTAAGAAAGG - Intronic
1104575858 12:129965315-129965337 TGGGCTGCTTTGTGTTAGAAGGG + Intergenic
1104781777 12:131426184-131426206 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1104901897 12:132193942-132193964 GAGGGAGCTGGTTGTTAGAAGGG - Intergenic
1105430468 13:20332789-20332811 CAGGAGGTTGTTTGTTAGACTGG + Intergenic
1106092003 13:26604430-26604452 CAGGCGGCTGTTTTTAAGTAAGG + Intronic
1106422873 13:29597872-29597894 CAGGCTTCTCTCTGTGAGAAGGG - Intergenic
1106864048 13:33944079-33944101 CAGGCTGCAGTGTATGAGAATGG - Intronic
1107020045 13:35741944-35741966 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1107117484 13:36762616-36762638 CAGGCTGCTCTTAGTTAAAAAGG + Intergenic
1107271557 13:38624732-38624754 CGGGCTGCTTTTTGTTAGAACGG - Intergenic
1108055112 13:46477821-46477843 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1109271631 13:60262014-60262036 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1109616998 13:64848142-64848164 TGGGCTGCTTTTTGTTAGAAGGG + Intergenic
1109703830 13:66062490-66062512 TAGGCTGCTCTTCGTTAGAAAGG + Intergenic
1110065150 13:71095209-71095231 CAGGCTGCTCCTTGTTAGAAAGG + Intergenic
1110386048 13:74911994-74912016 CTGGCTGCTAATTGTTAGAAGGG - Intergenic
1110467166 13:75815098-75815120 CTGGCTGCTGTTGGGTAGGAAGG + Intronic
1111011621 13:82322925-82322947 GGGATTGCTGTTTGTTAGAAGGG - Intergenic
1111012644 13:82331137-82331159 AAGACTGCTTTTTGTTAGAAGGG - Intergenic
1111024635 13:82503055-82503077 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1112022585 13:95384601-95384623 TGGGCTGCTTTTGGTTAGAAGGG - Intergenic
1112260760 13:97875954-97875976 TGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1113323824 13:109264709-109264731 TGGGCTGCTTTTTGTGAGAAAGG - Intergenic
1113733069 13:112656524-112656546 CAGGCTGCTCTTTGTTAGAAAGG - Intronic
1115197059 14:30812594-30812616 TGGGCTGCTTTTTATTAGAAGGG + Intergenic
1115648598 14:35387080-35387102 TAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1118283683 14:64451715-64451737 CAGCCTCCTGTTTGCCAGAATGG - Intronic
1119091206 14:71783012-71783034 CAGGCTGCTCTTTATCAGAAAGG - Intergenic
1121262198 14:92574578-92574600 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
1124073730 15:26421387-26421409 CTGGCTCCTTTTTGTTAGCAGGG + Intergenic
1124559909 15:30761851-30761873 TGGGCTGCTTTTTGGTAGAAGGG + Intronic
1124671335 15:31643867-31643889 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
1126052091 15:44695302-44695324 CAGGCTGCTCTTTGTTAGAAAGG - Intronic
1127549037 15:60018725-60018747 CATGCTGCTGTATGTTACAATGG - Intronic
1127851477 15:62916045-62916067 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1127851482 15:62916078-62916100 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1128375637 15:67073285-67073307 CAGGCTGCTGTTTATAGGAAGGG - Intronic
1129487887 15:75894241-75894263 CAAGCCTCTGATTGTTAGAAAGG + Intronic
1129524379 15:76204564-76204586 CAGGCTGGTTTTTGTAAAAATGG - Exonic
1130024478 15:80259626-80259648 CTGGCTGCTGTTTGGAAGAATGG - Intergenic
1130036496 15:80366125-80366147 CCGGCTGCTCTTTGTTAGAAAGG - Intronic
1130122378 15:81062348-81062370 CAGGCTGCTGTGAGTAGGAAGGG + Intronic
1131683713 15:94750004-94750026 CAGGCAGCTGTCTCTTAGGATGG + Intergenic
1132024686 15:98395058-98395080 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1133207839 16:4244400-4244422 CACGCTGCTCTTTGTTAGAAAGG - Intergenic
1133509287 16:6442093-6442115 CAGGCTGCCGGGTGATAGAAAGG + Intronic
1133719327 16:8479814-8479836 CGGGGTGCTGTTTGTTACATAGG - Intergenic
1134485931 16:14658470-14658492 CAGGCTGCTGTTTGTTAGAAAGG + Intronic
1134572232 16:15300900-15300922 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134572296 16:15301549-15301571 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134730084 16:16454499-16454521 CAGGCTGCTGATTGTTCTCAGGG - Intergenic
1134730149 16:16455148-16455170 CAGGCTGCTGATTGTTCTGAGGG - Intergenic
1134937282 16:18256751-18256773 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134937348 16:18257401-18257423 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1136341208 16:29644720-29644742 CAGGCTGATGTCTCTGAGAAGGG - Intergenic
1136423342 16:30151529-30151551 CAGGCTACTCTTCGTTAGAAAGG + Intergenic
1137705304 16:50531536-50531558 CAAGCTGCTGTTTGCAAGGAGGG - Intergenic
1138065199 16:53933603-53933625 GAGGCTGCTCTTTTTTAAAAAGG + Intronic
1138648355 16:58441804-58441826 CTGGCTGCTTGTAGTTAGAAGGG - Intergenic
1138748523 16:59391535-59391557 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1138789945 16:59892020-59892042 CGGGCTTCTCTTTGTTGGAAAGG + Intergenic
1139090045 16:63634390-63634412 CTGTCTGCTTGTTGTTAGAAGGG + Intergenic
1139137730 16:64225058-64225080 CAGGCTGCCCTTTGTTAGAGAGG - Intergenic
1140533838 16:75691058-75691080 GGGGCTGCTTTTTGTTAGAAGGG - Intronic
1140747713 16:77995797-77995819 CAGGATGTTCTTTGCTAGAAAGG + Intergenic
1141413843 16:83854906-83854928 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1142923643 17:3213279-3213301 TGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1142965549 17:3578699-3578721 CAGGCATCTTTTTGGTAGAATGG - Intronic
1143466544 17:7140599-7140621 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1143749108 17:9015529-9015551 CAGGCTAATGTTTGTGAGGAGGG - Intergenic
1143808507 17:9450689-9450711 CATGCTGGTCTTTGCTAGAATGG - Intronic
1146052035 17:29562023-29562045 CAGGCTTGTGTGTGTGAGAAGGG - Exonic
1147853624 17:43461354-43461376 CAGGATGGTGTTTGATAGTATGG - Intergenic
1149187559 17:54017341-54017363 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1149248038 17:54734872-54734894 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1149327879 17:55550841-55550863 TGGGCTGCTTTTTGTTTGAAGGG + Intergenic
1149598573 17:57878519-57878541 AGAGCTGCTGTTTCTTAGAATGG - Intronic
1149793287 17:59497813-59497835 GAGGTTGCTGTTTGCTAGTATGG - Intergenic
1151059952 17:71080529-71080551 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1152557213 17:81059350-81059372 CAGGCTGCTGTTGGTTGCACTGG - Intronic
1153143602 18:2002694-2002716 TGGGCTGCTTTTTGTTACAAGGG - Intergenic
1153271865 18:3330470-3330492 AGGGCTGCTTTTTGTTAGAGGGG - Intergenic
1153310907 18:3676064-3676086 CAGGCTGCTGTTTGTTAGAAAGG - Intronic
1153574160 18:6504184-6504206 AGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1155669313 18:28349710-28349732 AGGGCTGCCTTTTGTTAGAAGGG + Intergenic
1155943340 18:31821705-31821727 TGCGCTGCTTTTTGTTAGAAGGG - Intergenic
1156291431 18:35751650-35751672 AGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1156305143 18:35872582-35872604 GAAGCTGCTTTTTGTTAGAAGGG - Intergenic
1156306248 18:35880429-35880451 GAAGATGCTTTTTGTTAGAAGGG - Intergenic
1156437832 18:37152806-37152828 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
1157059393 18:44269853-44269875 CTAGCTGTTCTTTGTTAGAAAGG + Intergenic
1157231122 18:45916937-45916959 CAGGGTGCTGATTCTTAAAAAGG + Intronic
1159252149 18:65893276-65893298 CAGGCTGCTCCTTGTTAGAAAGG - Intergenic
1159498000 18:69230751-69230773 TGGGCTGCTTTTCGTTAGAAAGG + Intergenic
1159675934 18:71284340-71284362 CGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1159707185 18:71706405-71706427 GTGGCTGCTTTTTGTTAAAAGGG - Intergenic
1160725232 19:614884-614906 CATGCTGCTGTTCGTGGGAATGG + Intronic
1161831117 19:6605257-6605279 GGGGCTGCTTTTTGTTAGAAGGG + Intergenic
1162880135 19:13652695-13652717 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1162918199 19:13885427-13885449 CAGCCTGCTGTGTGTGAGGAGGG - Intronic
1163037188 19:14577290-14577312 TGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1163313359 19:16527063-16527085 CAGGCTGCTGTTTCTCAGTGTGG + Intronic
1163470601 19:17494748-17494770 TGGGCTGCTTTTTGTTAGAAGGG + Intronic
1164161266 19:22627012-22627034 GAAGCTGCTTTTTGTTAGAAGGG + Intergenic
1164623511 19:29711962-29711984 TAGGCTGCTTTTTGTTAGAAGGG - Intronic
1164991406 19:32687154-32687176 CAGGCTGCTCTTCGTTAGAAAGG - Intergenic
1166602737 19:44112327-44112349 CAGGCTGCTCTTCCTTAGGAAGG + Intronic
1166653223 19:44591181-44591203 TGGGCTACTTTTTGTTAGAAGGG - Intergenic
1167899342 19:52607023-52607045 TGGGCAGCTTTTTGTTAGAAGGG + Intronic
1168376000 19:55879740-55879762 TGGGCTGGTTTTTGTTAGAAGGG + Intronic
925472459 2:4176758-4176780 CATGCTGCTGTTTATTAGAAAGG + Intergenic
925735800 2:6962473-6962495 GAGGTTGCTTTTTGTTAGAAGGG + Intronic
926490664 2:13522508-13522530 GGGGCTGCTTTTTGTTAGAAGGG + Intergenic
926606910 2:14907122-14907144 CTGGCTGCTGTGGGGTAGAAAGG + Intergenic
927631493 2:24777876-24777898 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
929079378 2:38107273-38107295 CAGGCTGCTCTTTGTTAGAAAGG - Intronic
929394042 2:41501642-41501664 CAGGCTGCTCTTTGTTAGGAAGG - Intergenic
930575976 2:53149398-53149420 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
931565858 2:63615095-63615117 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
931935756 2:67195016-67195038 GAGGGTCCTGTCTGTTAGAAGGG - Intergenic
932198053 2:69801338-69801360 GGGGCTGCTTTTTGTTACAAGGG + Intronic
932727443 2:74191668-74191690 TGGGCTGCTTTTTGTTAGAAAGG - Intergenic
933066966 2:77809372-77809394 TGGGCTGCTTTTTGTTAGGAGGG + Intergenic
933118513 2:78504428-78504450 CAGGCTGCTCTTTGTTAAAAAGG + Intergenic
934032708 2:88062564-88062586 AGGGCTGCTTTTTGTTAGAAGGG + Intergenic
935748293 2:106208728-106208750 TGGGCTGCTTTTTGTTAGAAGGG + Intergenic
935877735 2:107529607-107529629 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
936680314 2:114762628-114762650 CAGCCTGCTGGGTGTTAGGAGGG - Intronic
936771616 2:115920481-115920503 TAGGCTGCTGTTTGTTCGAAAGG + Intergenic
936956562 2:118028478-118028500 AGGGCTGCTTTTTGTTAGAAGGG + Intergenic
937010802 2:118560960-118560982 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
937010807 2:118560993-118561015 CAGGCTGCTCTTTGTTACAAAGG - Intergenic
937484134 2:122296187-122296209 CAGGCTGCACTTTGGTAGAAGGG - Intergenic
937798715 2:126056571-126056593 CAGGCTGTTCTTTGTTAGAAAGG - Intergenic
939939108 2:148328049-148328071 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
940552648 2:155180937-155180959 CAGGCTGCAGTGAGCTAGAATGG + Intergenic
943044066 2:182837405-182837427 CAAACTGCAGTTTGTGAGAAGGG - Intronic
943446452 2:187993743-187993765 CAGCCTGCTGTTTCTTTTAAAGG - Intergenic
943664314 2:190592693-190592715 CAGGCTCTTTTTTGTTAGAAAGG + Intergenic
943743273 2:191434326-191434348 CAGGTTGCAGTTTGTTAGGTAGG + Intergenic
945326826 2:208491863-208491885 CTGGCTGCTTGTTGTTAGAAGGG + Intronic
945354734 2:208827176-208827198 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
945448157 2:209962410-209962432 CTGGTTGGTGTTTGTTAAAAGGG + Intronic
947842633 2:233218171-233218193 CAGGCTGCTTTTTGTTAGAAAGG + Intronic
948588139 2:239034141-239034163 CAGGCTGCTGTCAGTTTGGATGG + Intergenic
1168912544 20:1461034-1461056 CAGGATGCTAATTCTTAGAAAGG - Intronic
1169118181 20:3080778-3080800 CAGGCTACTATTTCTTGGAAGGG - Intergenic
1169948525 20:11015503-11015525 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1169988470 20:11473211-11473233 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1170865196 20:20149472-20149494 CAGTCTGCTGCTTCTTACAAAGG - Intronic
1170936227 20:20812128-20812150 CAGGCTGTTCTTTGTTAGAAAGG - Intergenic
1171243571 20:23590097-23590119 GAGGGTCCTGTCTGTTAGAAGGG + Intergenic
1172370429 20:34385563-34385585 CAGAAAGCTGTTTGTCAGAAAGG + Intronic
1172707033 20:36889435-36889457 CAGGCTGCTGTGTGTCAGGAAGG - Intronic
1172956900 20:38766882-38766904 CTGGCTGCTGTTGGTCATAACGG + Intronic
1173432634 20:43003687-43003709 CAGGTTACTGCTAGTTAGAAAGG + Intronic
1178479654 21:32968543-32968565 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1179237289 21:39559226-39559248 CAGGCTGCTCTTGGTTAGAAAGG + Intronic
1181534706 22:23535308-23535330 CAGGCTCCTGGTCGCTAGAATGG + Intergenic
1181745201 22:24951300-24951322 CGGGCTGCTGTTTGGTAAACAGG + Intergenic
1181917087 22:26290199-26290221 CAGGCAGCTGTCTGGCAGAATGG - Intronic
1182052327 22:27323086-27323108 CAGGCTTCTAATTTTTAGAAAGG + Intergenic
1182112388 22:27732819-27732841 CTGGCTGCTGTTTGCTAGGGAGG - Intergenic
1183341163 22:37282620-37282642 CAGGGTGCTCTCTTTTAGAATGG + Intronic
1184827994 22:46966030-46966052 AAGACAGCTGTTTGTTAGAGTGG - Intronic
1185273483 22:49939229-49939251 GGGCCTGCTTTTTGTTAGAAGGG - Intergenic
949362098 3:3243047-3243069 AGGGCTGCTTTTTGTTAAAAGGG + Intergenic
951353988 3:21641813-21641835 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
951518488 3:23588656-23588678 CAGGGTGCTGTTAGTTAACAGGG - Intronic
952991010 3:38830701-38830723 CCTGCTGCTATTTGGTAGAATGG + Intergenic
953065581 3:39466587-39466609 AAGGCTGCTGTTGGTTGGATTGG + Intergenic
953632225 3:44628773-44628795 CAGGATGCTCATTGTTAGAGTGG + Intronic
954084847 3:48236160-48236182 TGGGCTGCTTTTTGTTAGAAAGG - Intergenic
956205915 3:66754592-66754614 CAGGCTGCTCTTTGTTACGGAGG - Intergenic
956706250 3:72001674-72001696 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
957512913 3:81213189-81213211 TAGCTTGCTGCTTGTTAGAATGG - Intergenic
958589009 3:96129695-96129717 CATGCTGTTTTTTGTTACAATGG - Intergenic
958628124 3:96653276-96653298 GAGGCTGCTTTTTGCTAAAAGGG - Intergenic
958833565 3:99117833-99117855 CAAGCTTCTGTTTGTGAGGAAGG + Intergenic
959115900 3:102177824-102177846 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
960109386 3:113830440-113830462 GTGGCTGCTTTTTGTTAAAAGGG + Intronic
961330169 3:126133786-126133808 CAGGCTGCTGGTGGTCAGTAGGG - Intronic
962268582 3:133961298-133961320 CAGGCTGCTGTAGGATAGCAGGG + Intronic
963004636 3:140715035-140715057 CAGGCTGCTTTTCATTTGAAAGG - Intergenic
963364743 3:144320776-144320798 GGCGCTGCTGTTTGTTAGAAAGG - Intergenic
963722146 3:148874027-148874049 CTGGCTGCTGGTTAGTAGAAGGG + Intronic
964354236 3:155835398-155835420 GGGGCCGCTTTTTGTTAGAAGGG - Intronic
964962199 3:162440236-162440258 CAGGCTGCTCTTCGTTAAAAAGG + Intergenic
965446719 3:168782138-168782160 GAGGCTGCTTTTTGTTAAAAGGG - Intergenic
967515282 3:190361689-190361711 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
967799053 3:193634138-193634160 CATTCTGCTGGTTGTAAGAATGG + Intronic
967912183 3:194551632-194551654 CAGGCTTCTGTATGTTGGAGGGG + Intergenic
968211091 3:196849403-196849425 CAGGCTGTTCTTTGTTAGAAAGG - Intergenic
969099254 4:4756620-4756642 TAGGCTGCTGGTAGTTAGGAAGG + Intergenic
970278243 4:14425748-14425770 GAGGGTCCTGTCTGTTAGAAGGG - Intergenic
970332006 4:14996128-14996150 CAGGCTGCTTGTGGTGAGAATGG + Intergenic
970417125 4:15870201-15870223 CAGACTGCTCTTTATTAGAAAGG - Intergenic
970865561 4:20755093-20755115 CTGTCTGTGGTTTGTTAGAAGGG + Intronic
971227113 4:24764623-24764645 CAGGCTGCTTATTATTAAAAGGG - Intergenic
971373017 4:26033379-26033401 GAGGGTACTGTTTTTTAGAAGGG + Intergenic
971408636 4:26346558-26346580 CAGTCTGCTCTTTGTGAGAAAGG + Intronic
972536739 4:40006329-40006351 TAGACTGCTCTTTGTTAGAAAGG + Intergenic
972683353 4:41328198-41328220 GAGGCTGCTTTTTGTTAAAAGGG + Intergenic
972886499 4:43497302-43497324 CAGTTTGCTATTTGTTAAAATGG + Intergenic
973336475 4:48961744-48961766 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
973658092 4:53072313-53072335 GGGGCTGCTGTTTGTTAAAAGGG - Intronic
973935576 4:55842663-55842685 GAGGGTCCTGTCTGTTAGAAGGG + Intergenic
974945841 4:68528170-68528192 CAGGCTGCTTTTTGTTAGCAAGG - Intergenic
974955715 4:68639072-68639094 CTGGCTGCTTTTTGTTAGCAAGG - Intronic
975582981 4:75923354-75923376 TGGGCTACTTTTTGTTAGAAAGG - Intronic
976389594 4:84495561-84495583 CAGGCGACTGTTTGTTAGTTTGG + Intronic
976668082 4:87621745-87621767 CAGGCTCCTGTTTCTTTGCAAGG + Intergenic
976732064 4:88273256-88273278 GAGGCTGCTTTTTGTTAAAAGGG - Intronic
976749617 4:88440858-88440880 TGGACTGCTTTTTGTTAGAAGGG + Intronic
976825423 4:89255321-89255343 CAAGTTGCTGTTTGTTCTAAAGG - Intronic
976899670 4:90158082-90158104 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
977119494 4:93080452-93080474 CAGGCTACTGTTTCTCAGAAAGG + Intronic
977380488 4:96266974-96266996 TGGGCCGCTTTTTGTTAGAAGGG + Intergenic
977627722 4:99205752-99205774 CAGTCTGCTCATTGCTAGAAAGG + Intronic
978357440 4:107892016-107892038 CGGGCTGCTTTCTGTTAGAAGGG + Intronic
981475548 4:145183246-145183268 CAGGCTCCAGTTTCTTACAAGGG - Intergenic
982078766 4:151766170-151766192 CAGGCTCCTGTTTGCTAGAGAGG - Intergenic
982903593 4:161039827-161039849 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
983062015 4:163171702-163171724 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
983063826 4:163188011-163188033 TGAGCTGCTTTTTGTTAGAAGGG + Intergenic
983138791 4:164122321-164122343 CAGGCTACTCTTAGTTAGAAAGG - Intronic
983706147 4:170662193-170662215 CAAGCTGCTCTTGGTTAGAAAGG - Intergenic
984133077 4:175902325-175902347 GAGGCTGCTTTTTATTAAAAGGG - Intronic
985065323 4:186115603-186115625 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
988279407 5:29126905-29126927 CATCCTGCTGATTGTTAGAGCGG + Intergenic
988476228 5:31588369-31588391 GTGGCTGCTTTTTGTTAAAAGGG + Intergenic
988633119 5:32952268-32952290 CAGGCTGCCCTTTGTTAGAAAGG + Intergenic
988775537 5:34475100-34475122 TGGGCTGCTTTTTGTTAAAAGGG - Intergenic
989189853 5:38660164-38660186 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
990439015 5:55825087-55825109 AAGGCTGCTTTTTATTAAAAGGG + Intergenic
991479190 5:67058823-67058845 CAGCCTTCTTTTTATTAGAAAGG - Intronic
991772882 5:70056375-70056397 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
991852175 5:70931799-70931821 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
992802774 5:80308895-80308917 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
994607959 5:101994823-101994845 GGGGCTGCTCTTTGTTAGATAGG - Intergenic
995605263 5:113847562-113847584 TGGGCTGCTTTTTATTAGAAGGG - Intergenic
996277606 5:121686476-121686498 GGGGCTGGTTTTTGTTAGAAGGG - Intergenic
997658319 5:135571576-135571598 CAGGCTGCTTTTTATCAAAAAGG - Exonic
998958480 5:147461013-147461035 TGGGCTGCTTTTTATTAGAAGGG - Intronic
998985123 5:147748456-147748478 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
999065841 5:148684640-148684662 CATGCTGGAGTTTGTGAGAAAGG - Intergenic
999589555 5:153130222-153130244 CAGGCTGCTCTTTGTTAGGAAGG - Intergenic
999606942 5:153326122-153326144 GAGGGTCCTGTATGTTAGAAGGG + Intergenic
1000854092 5:166378434-166378456 CAGGATGCTCTTTGTTAGAAAGG + Intergenic
1000961264 5:167603984-167604006 CAGGCAGCTGTTTATTAAATGGG - Intronic
1001345666 5:170896125-170896147 CAGGCTCCTGTTAGATGGAAAGG - Intronic
1001445713 5:171781211-171781233 CAGGCTGTTCTTTGTCAGAAAGG - Intergenic
1001731477 5:173963780-173963802 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1002300139 5:178253216-178253238 CAGGGTGCAGTTTTTCAGAAGGG - Intronic
1002699573 5:181113185-181113207 GAGGCTGCTTTTTGTTAGAAGGG - Intergenic
1004707934 6:18141831-18141853 TAGGCTGCTCTTTGTTAGAAAGG - Intronic
1005181148 6:23108458-23108480 CAGGCTACTCTTCGTTAGAAAGG + Intergenic
1005182048 6:23116747-23116769 CAGGCTACTCTTTGTTAGAAAGG + Intergenic
1006613770 6:35311406-35311428 CTGGCTTCTGTTTGTGGGAAGGG + Intronic
1007582318 6:42966811-42966833 CCGGCTGCTGTGGGTCAGAAGGG + Exonic
1007863885 6:44946014-44946036 CAGGATCCTGATTTTTAGAATGG - Intronic
1008723975 6:54393706-54393728 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1008957577 6:57232717-57232739 GAGTCTGCTATTTGTAAGAAAGG - Intergenic
1009361779 6:62823945-62823967 TGTGCTGCTTTTTGTTAGAAAGG - Intergenic
1009657193 6:66562350-66562372 CAGGCTTCTCTTTGTTAAAAAGG + Intergenic
1011122996 6:83975002-83975024 GAAGCTGCTTTTTGTTGGAAGGG + Intergenic
1012792036 6:103709822-103709844 GAGGGTCCTGTCTGTTAGAAGGG + Intergenic
1012903689 6:105038414-105038436 CAGGCTGCTGTTGGTCAGCAGGG + Intronic
1013186068 6:107759367-107759389 AAGGCTGCTGTTAGGCAGAATGG + Intronic
1013293539 6:108738960-108738982 TAGGCTGCTCTTTGCTGGAAAGG + Intergenic
1013631187 6:111987698-111987720 GGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1013919291 6:115381791-115381813 AAGGGTGCTGTTTGTAAGCAAGG + Intergenic
1014034119 6:116745311-116745333 TTGGCTGCTTTTTGTTAGAAGGG + Intergenic
1015314823 6:131806557-131806579 CAGGTTGCTCTTTGTTAGAAAGG + Intergenic
1016104543 6:140145984-140146006 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1016465415 6:144320378-144320400 CAGGCTGCTGATAGTGAGAGGGG + Intronic
1016485189 6:144529413-144529435 CATGCTGCTGTTTGTCTGAGTGG + Intronic
1018366326 6:163123403-163123425 CAAGCTGCTTTCTGTTAGAAAGG + Intronic
1018388892 6:163328324-163328346 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1018469738 6:164084687-164084709 CAATCTGCTTTTTGATAGAATGG + Intergenic
1018555741 6:165049225-165049247 CAGGGGGCTCTTTGCTAGAAAGG - Intergenic
1018567077 6:165165306-165165328 GAGGCTGCTTTTTGCTAAAAGGG + Intergenic
1020706676 7:11552632-11552654 CAGGCTGTTCTTTGTTAAAAAGG - Intronic
1021367119 7:19793337-19793359 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1022333542 7:29401803-29401825 TAAGTTGCTGTTTGTTTGAAAGG + Intronic
1022838460 7:34139163-34139185 CATGCTTCTGTTGGTTACAAAGG - Intronic
1023152859 7:37218463-37218485 CAAGCTGCTGTTCCTTAGGAGGG - Intronic
1024708360 7:51986355-51986377 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1025814676 7:64900463-64900485 CAGGCTGCTTTTGGTTAAAAGGG - Intronic
1026276485 7:68882180-68882202 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1026519907 7:71107598-71107620 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1026626291 7:71995398-71995420 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
1027288351 7:76673825-76673847 GGGGCTGCTTTTTGTTAAAAAGG + Intergenic
1028352292 7:89863526-89863548 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1028954005 7:96668336-96668358 CACACTCCTGTTTTTTAGAATGG + Intronic
1029219420 7:98976247-98976269 CATGCTGCTGTCTGTCAGAGAGG - Exonic
1029329499 7:99840152-99840174 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
1029585835 7:101470515-101470537 GGGGCTGCTTTTTGTTAAAAGGG + Intronic
1031182706 7:118437091-118437113 TAAGCTGCTTTTTGTTAAAAGGG + Intergenic
1031534360 7:122915145-122915167 TAGGCTGCTCATTGTTAGAAAGG + Intergenic
1031555933 7:123176137-123176159 CAGGCTGTAGTTTGTTTGCATGG - Intronic
1031988574 7:128180275-128180297 CAGGGAGCTGGCTGTTAGAAAGG + Intergenic
1032325395 7:130923896-130923918 CTGGCTGCTTTTAGTCAGAAGGG + Intergenic
1034027047 7:147716736-147716758 TGGGCTGCTTTTTGTTAGAAGGG + Intronic
1035825813 8:2643286-2643308 CAGGCTGCTCTTTGTTAAGACGG - Intergenic
1036382383 8:8245371-8245393 TGGGCTGCTTTTTGTCAGAAGGG - Intergenic
1036425045 8:8637248-8637270 CAGGCTGCTGTTTGTTAGAAAGG - Intergenic
1036427639 8:8660947-8660969 TGGGCTACTTTTTGTTAGAAGGG - Intergenic
1036916867 8:12812616-12812638 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1037010929 8:13841556-13841578 TGGGCTGATTTTTGTTAGAAGGG - Intergenic
1037175671 8:15943807-15943829 AGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1038338953 8:26668212-26668234 GGGGCTGCTTTTTGTTAGGAAGG - Intergenic
1038370060 8:26980030-26980052 CAGGTTGCTCTTTGTTAGAAAGG - Intergenic
1038381070 8:27095093-27095115 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1039511138 8:38092871-38092893 CAGGCTGCTGTTTGTTAGAAAGG + Intergenic
1040027281 8:42793284-42793306 GGGGCTGCTTTTTGTTAAAAAGG + Intronic
1040356832 8:46626739-46626761 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1040854825 8:51937703-51937725 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1041255926 8:55979788-55979810 CAGGCTGCTGCTTGGCAGAGAGG - Intronic
1041492760 8:58452761-58452783 AGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1041575406 8:59388817-59388839 CAGGCTCCTGTTGGTTATGATGG - Intergenic
1042626444 8:70763106-70763128 CAGGCTGTAGTCTGTGAGAAAGG + Intronic
1045504358 8:102768203-102768225 CAGGCTGCTGTTGTCAAGAAAGG - Intergenic
1045681663 8:104667206-104667228 CAGGCTGCTCTTTGTTAGAAAGG - Intronic
1047286028 8:123487866-123487888 TAGGCTGATTTTTGTTAAAAGGG - Intergenic
1047827595 8:128594383-128594405 TTGGCTGCTTTCTGTTAGAAGGG - Intergenic
1048052384 8:130830189-130830211 CAGGCTTTCCTTTGTTAGAAAGG - Intronic
1048472933 8:134719479-134719501 CAGGGTGCTGTTTGATTTAAGGG + Intergenic
1050165488 9:2760698-2760720 GGGGCTGCTTTTTGTTAAAAGGG - Intronic
1050654706 9:7814385-7814407 CAGGCTGCTTTTGGTCAGTAAGG - Intronic
1050910599 9:11064829-11064851 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1051065828 9:13101583-13101605 CACCCTGCTCTCTGTTAGAAAGG - Intergenic
1051491404 9:17670324-17670346 TGGGCTGCTTTTTGTTAGAAGGG + Intronic
1054800001 9:69338159-69338181 CATCCTGCTGTTTATTAAAATGG - Intronic
1055198414 9:73625795-73625817 TGGGCTGCTTTTTGTTAGAAGGG + Intergenic
1056520736 9:87398980-87399002 CTGGCTGCTCTTACTTAGAAAGG + Intergenic
1058247036 9:102640430-102640452 CGAGCTGCTTTTAGTTAGAAGGG - Intergenic
1058321414 9:103636253-103636275 CAGTCTGCGGTTAGTCAGAAAGG + Intergenic
1058824162 9:108759835-108759857 GAGGCTGCTTTTTGTTAAAAGGG - Intergenic
1059186848 9:112281958-112281980 TAGGCAGCTGTTTGTAAGACAGG - Intronic
1185720768 X:2379623-2379645 GATGCTGCTGTTTCTTAAAATGG + Intronic
1186046086 X:5537824-5537846 GGGGCTGCTTTTTGTTAAAAGGG + Intergenic
1186928336 X:14359645-14359667 AGGGCTGCTTTTTGTTAGAAGGG - Intergenic
1187594382 X:20755594-20755616 TAGGCTGCTTTTTGTTAGAAGGG + Intergenic
1188094630 X:26005932-26005954 GGGGCTTCTTTTTGTTAGAAGGG + Intergenic
1188250259 X:27884730-27884752 CAGGCTGCTCTTTGTTAGAAAGG - Intergenic
1188275355 X:28193576-28193598 TGGGTTGCTTTTTGTTAGAAGGG + Intergenic
1188790790 X:34405611-34405633 CAGGCTGCTGTTTCCTTCAAAGG + Intergenic
1188849639 X:35116031-35116053 TTGGCTGATTTTTGTTAGAAGGG - Intergenic
1189033620 X:37474397-37474419 TGGGCTGCTTTTTGTTAGAAGGG - Intronic
1189580828 X:42404474-42404496 CAGGCTGTTCTTTGTTAGAAAGG + Intergenic
1189697066 X:43675649-43675671 GAGGGTCCTGTCTGTTAGAAGGG - Intronic
1191174954 X:57489383-57489405 CATGCTGCTGTAAGTTAGTATGG + Intergenic
1191606731 X:63070934-63070956 CTGATTGCTGTTTGCTAGAATGG + Intergenic
1191608754 X:63088952-63088974 GGGGCTGCTTTTTGTTAAAAAGG + Intergenic
1191741367 X:64438745-64438767 CAGGCTGCTCTTTGTTAAAAAGG - Intergenic
1193328024 X:80205474-80205496 TGGGCTGCTTTTTGTCAGAAAGG - Intergenic
1193686840 X:84587076-84587098 GCTGCTGCTTTTTGTTAGAAGGG + Intergenic
1193735161 X:85147756-85147778 GAGGGTCCTGTCTGTTAGAAGGG + Intergenic
1193791418 X:85819804-85819826 TAGGCCGCTCTTTGTTAGAAAGG - Intergenic
1194161162 X:90454184-90454206 CACTCTGCTTTTTGTTAGAAGGG + Intergenic
1194350060 X:92816177-92816199 CGGGTTGCTTTTTGTTAGAAGGG - Intergenic
1194482449 X:94442727-94442749 CAGGCTGCTCTTTGTTAGAAAGG + Intergenic
1194686404 X:96923173-96923195 CAGGCTGCTGTTAGTTTGAAAGG + Intronic
1196287464 X:113898985-113899007 CAGGCTGCTCTTCGTTAGAAAGG + Intergenic
1196927993 X:120653030-120653052 CAGGCTGCTTTTTGTTAAAAAGG - Intergenic
1198317212 X:135480085-135480107 CAGGCTGCTCTTCATTAGAAAGG - Intergenic
1198506513 X:137306850-137306872 CAGGGTGATGTTGGTTGGAATGG - Intergenic
1199135319 X:144243479-144243501 CAGGCTGCTCTTCGTTAGAAAGG - Intergenic
1199303492 X:146240168-146240190 CAGGCCACTGTTAGTTATAAGGG - Intergenic
1199489471 X:148382494-148382516 CTGGCTGCACTTTGCTAGAATGG + Intergenic
1200507452 Y:4031114-4031136 CACTCTGCTTTTTGTTAGAAGGG + Intergenic
1201276537 Y:12303969-12303991 GGGGCTGCTTTTTGTTAAAAGGG - Intergenic
1201973295 Y:19818856-19818878 TGGGCTGCTTTTTGCTAGAAGGG + Intergenic