ID: 1104351198

View in Genome Browser
Species Human (GRCh38)
Location 12:128045452-128045474
Sequence TGTTAGAAAGGAAAATAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104351195_1104351198 18 Left 1104351195 12:128045411-128045433 CCAATATCTATGTCTGCAGCTCG No data
Right 1104351198 12:128045452-128045474 TGTTAGAAAGGAAAATAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104351198 Original CRISPR TGTTAGAAAGGAAAATAACT TGG Intergenic
No off target data available for this crispr